4-3074876-CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG-CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG

Variant names:

• chr4-3074876-C-CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG
• rs71180116
• NM_001388492.1:c.81_110dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Benign. The variant received -16 ACMG points: 0P and 16B. BP6_Very_Strong BS1 BS2

The NM_001388492.1(HTT):​c.81_110dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA​(p.Gln28_Gln37dup) variant causes a disruptive inframe insertion change. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★★).

• Frequency:
  • Genomes: 𝑓 0.0040 (5 hom., cov: 0)
  • Exomes 𝑓: 0.0015 (19 hom.)
  • Failed GnomAD Quality Control
• Consequence: HTT NM_001388492.1 disruptive_inframe_insertion
• Clinical Significance: Benign/Likely benign criteria provided, multiple submitters, no conflicts B:2
• Conservation: PhyloP100: 4.84
• Publications: 6 publications found

Genes affected

HTT (HGNC:4851): (huntingtin) Huntingtin is a disease gene linked to Huntington's disease, a neurodegenerative disorder characterized by loss of striatal neurons. This is thought to be caused by an expanded, unstable trinucleotide repeat in the huntingtin gene, which translates as a polyglutamine repeat in the protein product. A fairly broad range of trinucleotide repeats (9-35) has been identified in normal controls, and repeat numbers in excess of 40 have been described as pathological. The huntingtin locus is large, spanning 180 kb and consisting of 67 exons. The huntingtin gene is widely expressed and is required for normal development. It is expressed as 2 alternatively polyadenylated forms displaying different relative abundance in various fetal and adult tissues. The larger transcript is approximately 13.7 kb and is expressed predominantly in adult and fetal brain whereas the smaller transcript of approximately 10.3 kb is more widely expressed. The genetic defect leading to Huntington's disease may not necessarily eliminate transcription, but may confer a new property on the mRNA or alter the function of the protein. One candidate is the huntingtin-associated protein-1, highly expressed in brain, which has increased affinity for huntingtin protein with expanded polyglutamine repeats. This gene contains an upstream open reading frame in the 5' UTR that inhibits expression of the huntingtin gene product through translational repression. [provided by RefSeq, Jul 2016]

HTT Gene-Disease associations (from GenCC):

• Huntington disease

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, ClinGen, Labcorp Genetics (formerly Invitae), Orphanet
• Lopes-Maciel-Rodan syndrome

  Inheritance: AR Classification: STRONG, LIMITED Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)
• juvenile Huntington disease

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Benign. The variant received -16 ACMG points.

• BP6: Variant 4-3074876-C-CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG is Benign according to our data. Variant chr4-3074876-C-CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG is described in ClinVar as Benign/Likely_benign. ClinVar VariationId is 2654593.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BS1: Variant frequency is greater than expected in population amr. GnomAd4 allele frequency = 0.00405 (534/131868) while in subpopulation AMR AF = 0.00619 (83/13410). AF 95% confidence interval is 0.00511. There are 5 homozygotes in GnomAd4. There are 223 alleles in the male GnomAd4 subpopulation. Median coverage is 0. This position passed quality control check.
• BS2: High Homozygotes in GnomAd4 at 5 AR,AD gene

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001388492.1. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	HTT	NM_001388492.1	MANE Select	c.81_110dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln28_Gln37dup	disruptive_inframe_insertion	Exon 1 of 67	NP_001375421.1
	HTT	NM_002111.8		c.81_110dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln28_Gln37dup	disruptive_inframe_insertion	Exon 1 of 67	NP_002102.4

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	HTT	ENST00000355072.11	TSL:1 MANE Select	c.81_110dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln28_Gln37dup	disruptive_inframe_insertion	Exon 1 of 67	ENSP00000347184.5
	HTT	ENST00000680291.1		n.226_255dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA		non_coding_transcript_exon	Exon 1 of 41
	HTT	ENST00000681528.1		c.6-12033_6-12004dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA		intron	N/A	ENSP00000506116.1

Frequencies

GnomAD3 genomes AF: 0.00404 AC: 533 AN: 131770 Hom.: 5 Cov.: 0

Gnomad AFR AF: 0.00311

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00620

Gnomad ASJ AF: 0.00313

Gnomad EAS AF: 0.00121

Gnomad SAS AF: 0.00153

Gnomad FIN AF: 0.00149

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00486

Gnomad OTH AF: 0.00501

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00150 AC: 1834 AN: 1225782 Hom.: 19 Cov.: 0 AF XY: 0.00160 AC XY: 976 AN XY: 608110

African (AFR) AF: 0.00132 AC: 34 AN: 25812

American (AMR) AF: 0.00330 AC: 100 AN: 30296

Ashkenazi Jewish (ASJ) AF: 0.00185 AC: 42 AN: 22736

East Asian (EAS) AF: 0.00148 AC: 43 AN: 29096

South Asian (SAS) AF: 0.00192 AC: 139 AN: 72228

European-Finnish (FIN) AF: 0.00215 AC: 70 AN: 32494

Middle Eastern (MID) AF: 0.00185 AC: 7 AN: 3784

European-Non Finnish (NFE) AF: 0.00137 AC: 1310 AN: 957500

Other (OTH) AF: 0.00172 AC: 89 AN: 51836

GnomAD4 genome AF: 0.00405 AC: 534 AN: 131868 Hom.: 5 Cov.: 0 AF XY: 0.00352 AC XY: 223 AN XY: 63418

African (AFR) AF: 0.00313 AC: 111 AN: 35514

American (AMR) AF: 0.00619 AC: 83 AN: 13410

Ashkenazi Jewish (ASJ) AF: 0.00313 AC: 10 AN: 3190

East Asian (EAS) AF: 0.00121 AC: 5 AN: 4124

South Asian (SAS) AF: 0.00153 AC: 6 AN: 3910

European-Finnish (FIN) AF: 0.00149 AC: 11 AN: 7368

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 252

European-Non Finnish (NFE) AF: 0.00486 AC: 299 AN: 61484

Other (OTH) AF: 0.00496 AC: 9 AN: 1816

ClinVar

ClinVar submissions as Germline

Significance: Benign/Likely benign

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	-	1	not provided (1)
-	-	1	not specified (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.8
Mutation Taster		=80/20	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs71180116; hg19: chr4-3076603;