4-3074876-CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG-CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG

Variant names:

• chr4-3074876-C-CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG
• rs71180116
• NM_001388492.1:c.75_110dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Benign. The variant received -8 ACMG points: 0P and 8B. BS1 BS2

The NM_001388492.1(HTT):​c.75_110dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA​(p.Gln26_Gln37dup) variant causes a disruptive inframe insertion change. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.0020 (2 hom., cov: 0)
  • Exomes 𝑓: 0.00079 (15 hom.)
  • Failed GnomAD Quality Control
• Consequence: HTT NM_001388492.1 disruptive_inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 4.84
• Publications: 6 publications found

Genes affected

HTT (HGNC:4851): (huntingtin) Huntingtin is a disease gene linked to Huntington's disease, a neurodegenerative disorder characterized by loss of striatal neurons. This is thought to be caused by an expanded, unstable trinucleotide repeat in the huntingtin gene, which translates as a polyglutamine repeat in the protein product. A fairly broad range of trinucleotide repeats (9-35) has been identified in normal controls, and repeat numbers in excess of 40 have been described as pathological. The huntingtin locus is large, spanning 180 kb and consisting of 67 exons. The huntingtin gene is widely expressed and is required for normal development. It is expressed as 2 alternatively polyadenylated forms displaying different relative abundance in various fetal and adult tissues. The larger transcript is approximately 13.7 kb and is expressed predominantly in adult and fetal brain whereas the smaller transcript of approximately 10.3 kb is more widely expressed. The genetic defect leading to Huntington's disease may not necessarily eliminate transcription, but may confer a new property on the mRNA or alter the function of the protein. One candidate is the huntingtin-associated protein-1, highly expressed in brain, which has increased affinity for huntingtin protein with expanded polyglutamine repeats. This gene contains an upstream open reading frame in the 5' UTR that inhibits expression of the huntingtin gene product through translational repression. [provided by RefSeq, Jul 2016]

HTT Gene-Disease associations (from GenCC):

• Huntington disease

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, ClinGen, Labcorp Genetics (formerly Invitae), Orphanet
• Lopes-Maciel-Rodan syndrome

  Inheritance: AR Classification: STRONG, LIMITED Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)
• juvenile Huntington disease

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Benign. The variant received -8 ACMG points.

• BS1: Variant frequency is greater than expected in population amr. GnomAd4 allele frequency = 0.002 (264/131882) while in subpopulation AMR AF = 0.00373 (50/13412). AF 95% confidence interval is 0.0029. There are 2 homozygotes in GnomAd4. There are 128 alleles in the male GnomAd4 subpopulation. Median coverage is 0. This position passed quality control check.
• BS2: High Homozygotes in GnomAd4 at 2 AR,AD gene

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001388492.1. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	HTT	NM_001388492.1	MANE Select	c.75_110dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln26_Gln37dup	disruptive_inframe_insertion	Exon 1 of 67	NP_001375421.1
	HTT	NM_002111.8		c.75_110dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln26_Gln37dup	disruptive_inframe_insertion	Exon 1 of 67	NP_002102.4

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	HTT	ENST00000355072.11	TSL:1 MANE Select	c.75_110dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln26_Gln37dup	disruptive_inframe_insertion	Exon 1 of 67	ENSP00000347184.5
	HTT	ENST00000680291.1		n.220_255dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA		non_coding_transcript_exon	Exon 1 of 41
	HTT	ENST00000681528.1		c.6-12039_6-12004dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA		intron	N/A	ENSP00000506116.1

Frequencies

GnomAD3 genomes AF: 0.00200 AC: 263 AN: 131784 Hom.: 2 Cov.: 0

Gnomad AFR AF: 0.00138

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00373

Gnomad ASJ AF: 0.00157

Gnomad EAS AF: 0.000725

Gnomad SAS AF: 0.000511

Gnomad FIN AF: 0.00149

Gnomad MID AF: 0.00373

Gnomad NFE AF: 0.00223

Gnomad OTH AF: 0.00278

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000794 AC: 973 AN: 1225848 Hom.: 15 Cov.: 0 AF XY: 0.000867 AC XY: 527 AN XY: 608152

African (AFR) AF: 0.000659 AC: 17 AN: 25814

American (AMR) AF: 0.00165 AC: 50 AN: 30304

Ashkenazi Jewish (ASJ) AF: 0.000660 AC: 15 AN: 22734

East Asian (EAS) AF: 0.000825 AC: 24 AN: 29096

South Asian (SAS) AF: 0.000886 AC: 64 AN: 72232

European-Finnish (FIN) AF: 0.00191 AC: 62 AN: 32498

Middle Eastern (MID) AF: 0.00106 AC: 4 AN: 3784

European-Non Finnish (NFE) AF: 0.000702 AC: 672 AN: 957552

Other (OTH) AF: 0.00125 AC: 65 AN: 51834

GnomAD4 genome AF: 0.00200 AC: 264 AN: 131882 Hom.: 2 Cov.: 0 AF XY: 0.00202 AC XY: 128 AN XY: 63426

African (AFR) AF: 0.00138 AC: 49 AN: 35522

American (AMR) AF: 0.00373 AC: 50 AN: 13412

Ashkenazi Jewish (ASJ) AF: 0.00157 AC: 5 AN: 3190

East Asian (EAS) AF: 0.000727 AC: 3 AN: 4124

South Asian (SAS) AF: 0.000767 AC: 3 AN: 3910

European-Finnish (FIN) AF: 0.00149 AC: 11 AN: 7368

Middle Eastern (MID) AF: 0.00397 AC: 1 AN: 252

European-Non Finnish (NFE) AF: 0.00223 AC: 137 AN: 61488

Other (OTH) AF: 0.00275 AC: 5 AN: 1816

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.8
Mutation Taster		=80/20	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs71180116; hg19: chr4-3076603;