4-3074876-CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG-CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG

Variant names:

• chr4-3074876-C-CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG
• rs71180116
• NM_001388492.1:c.54_110dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Uncertain significance. Variant got 1 ACMG points: 2P and 1B. PP5_Moderate BP3

The NM_001388492.1(HTT):​c.54_110dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA​(p.Gln19_Gln37dup) variant causes a disruptive inframe insertion change. Variant has been reported in ClinVar as Likely pathogenic (★).

• Frequency:
  • Genomes: 𝑓 0.000053 (0 hom., cov: 0)
  • Exomes 𝑓: 0.000033 (1 hom.)
  • Failed GnomAD Quality Control
• Consequence: HTT NM_001388492.1 disruptive_inframe_insertion
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 4.84

Genes affected

HTT (HGNC:4851): (huntingtin) Huntingtin is a disease gene linked to Huntington's disease, a neurodegenerative disorder characterized by loss of striatal neurons. This is thought to be caused by an expanded, unstable trinucleotide repeat in the huntingtin gene, which translates as a polyglutamine repeat in the protein product. A fairly broad range of trinucleotide repeats (9-35) has been identified in normal controls, and repeat numbers in excess of 40 have been described as pathological. The huntingtin locus is large, spanning 180 kb and consisting of 67 exons. The huntingtin gene is widely expressed and is required for normal development. It is expressed as 2 alternatively polyadenylated forms displaying different relative abundance in various fetal and adult tissues. The larger transcript is approximately 13.7 kb and is expressed predominantly in adult and fetal brain whereas the smaller transcript of approximately 10.3 kb is more widely expressed. The genetic defect leading to Huntington's disease may not necessarily eliminate transcription, but may confer a new property on the mRNA or alter the function of the protein. One candidate is the huntingtin-associated protein-1, highly expressed in brain, which has increased affinity for huntingtin protein with expanded polyglutamine repeats. This gene contains an upstream open reading frame in the 5' UTR that inhibits expression of the huntingtin gene product through translational repression. [provided by RefSeq, Jul 2016]

ACMG classification

Verdict is Uncertain_significance. Variant got 1 ACMG points.

• PP5: Variant 4-3074876-C-CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG is Pathogenic according to our data. Variant chr4-3074876-C-CCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG is described in ClinVar as [Likely_pathogenic]. Clinvar id is 1687507.Status of the report is criteria_provided_single_submitter, 1 stars.
• BP3: Nonframeshift variant in repetitive region in NM_001388492.1

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
HTT	NM_001388492.1	c.54_110dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln19_Gln37dup	disruptive_inframe_insertion	Exon 1 of 67	ENST00000355072.11	NP_001375421.1
HTT	NM_002111.8	c.54_110dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln19_Gln37dup	disruptive_inframe_insertion	Exon 1 of 67		NP_002102.4

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
HTT	ENST00000355072.11	c.54_110dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln19_Gln37dup	disruptive_inframe_insertion	Exon 1 of 67	1	NM_001388492.1	ENSP00000347184.5

Frequencies

GnomAD3 genomes AF: 0.0000531 AC: 7 AN: 131786 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.0000282

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0000746

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000813

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000326 AC: 40 AN: 1225874 Hom.: 1 Cov.: 0 AF XY: 0.0000362 AC XY: 22 AN XY: 608160

Gnomad4 AFR exome AF: 0.0000387

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.0000880

Gnomad4 EAS exome AF: 0.000103

Gnomad4 SAS exome AF: 0.0000831

Gnomad4 FIN exome AF: 0.000123

Gnomad4 NFE exome AF: 0.0000230

Gnomad4 OTH exome AF: 0.0000386

GnomAD4 genome AF: 0.0000531 AC: 7 AN: 131786 Hom.: 0 Cov.: 0 AF XY: 0.0000316 AC XY: 2 AN XY: 63316

Gnomad4 AFR AF: 0.0000282

Gnomad4 AMR AF: 0.0000746

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000813

Gnomad4 OTH AF: 0.00

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Huntington disease Pathogenic:1

May 22, 2022

3billion

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The variant is not observed in the gnomAD v2.1.1 dataset. Inframe insertion variant (CAG repeat expansion). The variant has been reported to be associated with HTT related disorder (PMID: 25356969, ClinVar ID: VCV000031916). Therefore, this variant is classified as pathogenic according to the recommendation of ACMG/AMP guideline. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs71180116; hg19: chr4-3076603;