4-41745990-TGCCGCCGCCGCCGCTGCCGCGGCCGCC-TGCCGCC
Variant summary
Our verdict is Benign. The variant received -17 ACMG points: 0P and 17B. BP3BP6_Very_StrongBS1BS2
The NM_003924.4(PHOX2B):c.741_761delCGCGGCAGCGGCGGCGGCGGC(p.Ala248_Ala254del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000354 in 1,235,952 control chromosomes in the GnomAD database, including 8 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★★). Synonymous variant affecting the same amino acid position (i.e. A247A) has been classified as Likely benign.
Frequency
Consequence
NM_003924.4 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- central hypoventilation syndrome, congenital, 1, with or without Hirschsprung diseaseInheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), ClinGen, G2P
- Haddad syndromeInheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
- neuroblastoma, susceptibility to, 2Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, G2P
- congenital central hypoventilation syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Benign. The variant received -17 ACMG points.
Transcripts
RefSeq
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
PHOX2B | ENST00000226382.4 | c.741_761delCGCGGCAGCGGCGGCGGCGGC | p.Ala248_Ala254del | disruptive_inframe_deletion | Exon 3 of 3 | 1 | NM_003924.4 | ENSP00000226382.2 | ||
PHOX2B | ENST00000510424.2 | n.*22_*42delCGCGGCAGCGGCGGCGGCGGC | downstream_gene_variant | 3 |
Frequencies
GnomAD3 genomes AF: 0.000450 AC: 66AN: 146666Hom.: 0 Cov.: 32 show subpopulations
GnomAD2 exomes AF: 0.000279 AC: 6AN: 21500 AF XY: 0.000151 show subpopulations
GnomAD4 exome AF: 0.000340 AC: 370AN: 1089186Hom.: 8 AF XY: 0.000325 AC XY: 170AN XY: 522640 show subpopulations
GnomAD4 genome AF: 0.000457 AC: 67AN: 146766Hom.: 0 Cov.: 32 AF XY: 0.000392 AC XY: 28AN XY: 71486 show subpopulations
ClinVar
Submissions by phenotype
not provided Benign:2
This variant is associated with the following publications: (PMID: 27535533) -
PHOX2B: BS1 -
Haddad syndrome Benign:1
- -
Hereditary cancer-predisposing syndrome Benign:1
- -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at