4-41745990-TGCCGCCGCCGCCGCTGCCGCGGCCGCC-TGCCGCC

Variant names:

• chr4-41745990-TGCCGCCGCCGCCGCTGCCGCG-T
• rs749694204
• NM_003924.4:c.741_761delCGCGGCAGCGGCGGCGGCGGC

Variant summary

Our verdict is Benign. Variant got -17 ACMG points: 0P and 17B. BP3 BP6_Very_Strong BS1 BS2

The NM_003924.4(PHOX2B):​c.741_761delCGCGGCAGCGGCGGCGGCGGC​(p.Ala248_Ala254del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000354 in 1,235,952 control chromosomes in the GnomAD database, including 8 homozygotes. Variant has been reported in ClinVar as Likely benign (★★).

• Frequency:
  • Genomes: 𝑓 0.00046 (0 hom., cov: 32)
  • Exomes 𝑓: 0.00034 (8 hom.)
• Consequence: PHOX2B NM_003924.4 disruptive_inframe_deletion
• Clinical Significance: Benign/Likely benign criteria provided, multiple submitters, no conflicts B:4
• Conservation: PhyloP100: 3.12

Genes affected

PHOX2B (HGNC:9143): (paired like homeobox 2B) The DNA-associated protein encoded by this gene is a member of the paired family of homeobox proteins localized to the nucleus. The protein functions as a transcription factor involved in the development of several major noradrenergic neuron populations and the determination of neurotransmitter phenotype. The gene product is linked to enhancement of second messenger-mediated activation of the dopamine beta-hydroylase, c-fos promoters and several enhancers, including cyclic amp-response element and serum-response element. Expansion of a 20 amino acid polyalanine tract in this protein by 5-13 aa has been associated with congenital central hypoventilation syndrome. [provided by RefSeq, Jul 2016]

ACMG classification

Verdict is Benign. Variant got -17 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_003924.4
• BP6: Variant 4-41745990-TGCCGCCGCCGCCGCTGCCGCG-T is Benign according to our data. Variant chr4-41745990-TGCCGCCGCCGCCGCTGCCGCG-T is described in ClinVar as [Likely_benign]. Clinvar id is 239591.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars. Variant chr4-41745990-TGCCGCCGCCGCCGCTGCCGCG-T is described in Lovd as [Pathogenic].
• BS1: Variant frequency is greater than expected in population amr. gnomad4 allele frequency = 0.000457 (67/146766) while in subpopulation AMR AF= 0.000894 (13/14544). AF 95% confidence interval is 0.000529. There are 0 homozygotes in gnomad4. There are 28 alleles in male gnomad4 subpopulation. Median coverage is 32. This position pass quality control queck.
• BS2: High AC in GnomAd4 at 67 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
PHOX2B	NM_003924.4	c.741_761delCGCGGCAGCGGCGGCGGCGGC	p.Ala248_Ala254del	disruptive_inframe_deletion	Exon 3 of 3	ENST00000226382.4	NP_003915.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
PHOX2B	ENST00000226382.4	c.741_761delCGCGGCAGCGGCGGCGGCGGC	p.Ala248_Ala254del	disruptive_inframe_deletion	Exon 3 of 3	1	NM_003924.4	ENSP00000226382.2
PHOX2B	ENST00000510424.2	n.*22_*42delCGCGGCAGCGGCGGCGGCGGC		downstream_gene_variant		3

Frequencies

GnomAD3 genomes AF: 0.000450 AC: 66 AN: 146666 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.000713

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000895

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000348

Gnomad OTH AF: 0.000496

GnomAD3 exomes AF: 0.000279 AC: 6 AN: 21500 Hom.: 0 AF XY: 0.000151 AC XY: 2 AN XY: 13204

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00262

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.000325

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.000340 AC: 370 AN: 1089186 Hom.: 8 AF XY: 0.000325 AC XY: 170 AN XY: 522640

Gnomad4 AFR exome AF: 0.000454

Gnomad4 AMR exome AF: 0.000836

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.0000416

Gnomad4 SAS exome AF: 0.000642

Gnomad4 FIN exome AF: 0.000109

Gnomad4 NFE exome AF: 0.000346

Gnomad4 OTH exome AF: 0.000305

GnomAD4 genome AF: 0.000457 AC: 67 AN: 146766 Hom.: 0 Cov.: 32 AF XY: 0.000392 AC XY: 28 AN XY: 71486

Gnomad4 AFR AF: 0.000736

Gnomad4 AMR AF: 0.000894

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.000348

Gnomad4 OTH AF: 0.000490

Bravo AF: 0.000385

ClinVar

Significance: Benign/Likely benign

Submissions summary: Benign:4

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not provided Benign:2

Jun 09, 2021

GeneDx

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant is associated with the following publications: (PMID: 27535533) -

Feb 01, 2024

CeGaT Center for Human Genetics Tuebingen

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

PHOX2B: BS1 -

Haddad syndrome Benign:1

Nov 05, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Hereditary cancer-predisposing syndrome Benign:1

Mar 10, 2021

Sema4, Sema4

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: curation

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs749694204; hg19: chr4-41748007;