4-41746002-CGCTGCCGCGGCCGCCGCCGCT-C
Variant summary
Our verdict is Likely benign. Variant got -5 ACMG points: 0P and 5B. BS1_SupportingBS2
The NM_003924.4(PHOX2B):c.729_749delAGCGGCGGCGGCCGCGGCAGC(p.Ala244_Ala250del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000689 in 1,161,834 control chromosomes in the GnomAD database, including 3 homozygotes. Variant has been reported in ClinVar as Uncertain significance (★★).
Frequency
Consequence
NM_003924.4 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Likely_benign. Variant got -5 ACMG points.
Transcripts
RefSeq
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
PHOX2B | ENST00000226382.4 | c.729_749delAGCGGCGGCGGCCGCGGCAGC | p.Ala244_Ala250del | disruptive_inframe_deletion | Exon 3 of 3 | 1 | NM_003924.4 | ENSP00000226382.2 | ||
PHOX2B | ENST00000510424.2 | n.*10_*30delAGCGGCGGCGGCCGCGGCAGC | downstream_gene_variant | 3 |
Frequencies
GnomAD3 genomes AF: 0.000130 AC: 19AN: 145980Hom.: 0 Cov.: 32
GnomAD3 exomes AF: 0.000537 AC: 4AN: 7454Hom.: 0 AF XY: 0.000492 AC XY: 2AN XY: 4064
GnomAD4 exome AF: 0.0000601 AC: 61AN: 1015756Hom.: 3 AF XY: 0.0000888 AC XY: 43AN XY: 484012
GnomAD4 genome AF: 0.000130 AC: 19AN: 146078Hom.: 0 Cov.: 32 AF XY: 0.000225 AC XY: 16AN XY: 71148
ClinVar
Submissions by phenotype
Haddad syndrome Uncertain:1
In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. This variant, c.729_749del, results in the deletion of 7 amino acids of the PHOX2B protein (p.Ala254_Ala260del), but otherwise preserves the integrity of the reading frame. While this variant is present in population databases (rs772448418), the frequency information is unreliable, as metrics indicate poor data quality at this position in the ExAC database. This variant has not been reported in the literature in individuals with PHOX2B-related disease. Experimental studies and prediction algorithms are not available for this variant, and the functional significance of the deleted amino acids is currently unknown. -
not provided Uncertain:1
In-frame deletion of 7 amino acids in a repetitive region with no known function; Has not been previously published as pathogenic or benign to our knowledge -
PHOX2B-related disorder Benign:1
This variant is classified as likely benign based on ACMG/AMP sequence variant interpretation guidelines (Richards et al. 2015 PMID: 25741868, with internal and published modifications). -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at