4-52038237-GCCGCCGCCGCCGCTGCCGCCATCTTCCCGCGC-GCCGCCGCCGCCGCTGCCGCCATCTTCCCGCGCCCGCCGCCGCCGCTGCCGCCATCTTCCCGCGC

Variant names:

• chr4-52038237-G-GCCGCCGCCGCCGCTGCCGCCATCTTCCCGCGC
• rs1553940963
• NM_000232.5:c.-10_22dupGCGCGGGAAGATGGCGGCAGCGGCGGCGGCGG

Variant summary

Our verdict is Pathogenic. The variant received 13 ACMG points: 13P and 0B. PVS1 PS3 PP5

The NM_000232.5(SGCB):​c.-10_22dupGCGCGGGAAGATGGCGGCAGCGGCGGCGGCGG​(p.Ala8GlyfsTer22) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000767 in 1,265,076 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). ClinVar reports functional evidence for this variant: "SCV000642375: Studies have shown that this variant alters SGCB gene expression (PMID:25862795).". Synonymous variant affecting the same amino acid position (i.e. A8A) has been classified as Likely benign. The gene SGCB is included in the ClinGen Criteria Specification Registry.

• Frequency:
  • Genomes: 𝑓 0.000060 (0 hom., cov: 32)
  • Exomes 𝑓: 0.000079 (0 hom.)
• Consequence: SGCB NM_000232.5 frameshift
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications P:5 U:1
• Conservation: PhyloP100: 1.09
• Publications: 1 publications found

Genes affected

SGCB (HGNC:10806): (sarcoglycan beta) This gene encodes a member of the sarcoglycan family. Sarcoglycans are transmembrane components in the dystrophin-glycoprotein complex which help stabilize the muscle fiber membranes and link the muscle cytoskeleton to the extracellular matrix. Mutations in this gene have been associated with limb-girdle muscular dystrophy.[provided by RefSeq, Oct 2008]

SGCB Gene-Disease associations (from GenCC):

• autosomal recessive limb-girdle muscular dystrophy

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: ClinGen, PanelApp Australia
• autosomal recessive limb-girdle muscular dystrophy type 2E

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Myriad Women’s Health, Orphanet, Labcorp Genetics (formerly Invitae), Ambry Genetics

ACMG classification

Specifications for SGCB are available in the ClinGen Criteria Specification Registry and recommended for reference when assigning criteria.

Our verdict: Pathogenic. The variant received 13 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 91 pathogenic variants in the truncated region.
• PS3: PS3 evidence extracted from ClinVar submissions: SCV000642375: Studies have shown that this variant alters SGCB gene expression (PMID: 25862795).
• PP5: Variant 4-52038237-G-GCCGCCGCCGCCGCTGCCGCCATCTTCCCGCGC is Pathogenic according to our data. Variant chr4-52038237-G-GCCGCCGCCGCCGCTGCCGCCATCTTCCCGCGC is described in ClinVar as Conflicting_classifications_of_pathogenicity. ClinVar VariationId is 466601.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000232.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SGCB	NM_000232.5	MANE Select	c.-10_22dupGCGCGGGAAGATGGCGGCAGCGGCGGCGGCGG	p.Ala8GlyfsTer22	frameshift	Exon 1 of 6	NP_000223.1	Q5U0N0
	SGCB	NM_001440519.1		c.-10_22dupGCGCGGGAAGATGGCGGCAGCGGCGGCGGCGG	p.Ala8GlyfsTer16	frameshift	Exon 1 of 5	NP_001427448.1
	SGCB	NM_001440520.1		c.-417_-386dupGCGCGGGAAGATGGCGGCAGCGGCGGCGGCGG		5_prime_UTR	Exon 1 of 7	NP_001427449.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SGCB	ENST00000381431.10	TSL:1 MANE Select	c.-10_22dupGCGCGGGAAGATGGCGGCAGCGGCGGCGGCGG	p.Ala8GlyfsTer22	frameshift	Exon 1 of 6	ENSP00000370839.6	Q16585-1
	SGCB	ENST00000899666.1		c.-10_22dupGCGCGGGAAGATGGCGGCAGCGGCGGCGGCGG	p.Ala8GlyfsTer22	frameshift	Exon 1 of 6	ENSP00000569725.1
	SGCB	ENST00000912466.1		c.-10_22dupGCGCGGGAAGATGGCGGCAGCGGCGGCGGCGG	p.Ala8GlyfsTer22	frameshift	Exon 1 of 5	ENSP00000582525.1

Frequencies

GnomAD3 genomes AF: 0.0000597 AC: 9 AN: 150846 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.0000969

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000741

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.0000790 AC: 88 AN: 1114230 Hom.: 0 Cov.: 31 AF XY: 0.0000764 AC XY: 41 AN XY: 536482

African (AFR) AF: 0.0000862 AC: 2 AN: 23212

American (AMR) AF: 0.00 AC: 0 AN: 16088

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 16098

East Asian (EAS) AF: 0.00 AC: 0 AN: 24044

South Asian (SAS) AF: 0.00 AC: 0 AN: 32586

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 22680

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 3016

European-Non Finnish (NFE) AF: 0.0000922 AC: 86 AN: 932444

Other (OTH) AF: 0.00 AC: 0 AN: 44062

GnomAD4 genome AF: 0.0000597 AC: 9 AN: 150846 Hom.: 0 Cov.: 32 AF XY: 0.0000543 AC XY: 4 AN XY: 73642

African (AFR) AF: 0.0000969 AC: 4 AN: 41276

American (AMR) AF: 0.00 AC: 0 AN: 15146

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3464

East Asian (EAS) AF: 0.00 AC: 0 AN: 5120

South Asian (SAS) AF: 0.00 AC: 0 AN: 4824

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10256

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 312

European-Non Finnish (NFE) AF: 0.0000741 AC: 5 AN: 67468

Other (OTH) AF: 0.00 AC: 0 AN: 2072

ClinVar

ClinVar submissions

Significance: Conflicting classifications of pathogenicity

Revision: criteria provided, conflicting classifications

Pathogenic	VUS	Benign	Condition
4	-	-	Autosomal recessive limb-girdle muscular dystrophy type 2E (4)
1	-	-	Autosomal recessive limb-girdle muscular dystrophy (1)
-	1	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.1
Mutation Taster		=26/174	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1553940963; hg19: chr4-52904403;