4-70481421-CATCTTCCTCAGCTCCACCAGAGACCACAGCTGCCCCACCCACACCTTCTGCAACTACACCAGCTCCACT-C

Variant names:

• chr4-70481421-CATCTTCCTCAGCTCCACCAGAGACCACAGCTGCCCCACCCACACCTTCTGCAACTACACCAGCTCCACT-C
• rs1560560839
• NM_152291.3:c.710_778delCCCCACCCACACCTTCTGCAACTACACCAGCTCCACTATCTTCCTCAGCTCCACCAGAGACCACAGCTG

Variant summary

Our verdict is Benign. The variant received -8 ACMG points: 2P and 10B. PM4 BP6_Moderate BA1

The NM_152291.3(MUC7):​c.710_778delCCCCACCCACACCTTCTGCAACTACACCAGCTCCACTATCTTCCTCAGCTCCACCAGAGACCACAGCTG​(p.Ala237_Ala259del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0261 in 148,582 control chromosomes in the GnomAD database, including 326 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Benign (★).

• Frequency:
  • Genomes: 𝑓 0.026 (326 hom., cov: 23)
  • Exomes 𝑓: 0.026 (2701 hom.)
  • Failed GnomAD Quality Control
• Consequence: MUC7 NM_152291.3 disruptive_inframe_deletion
• Clinical Significance: Benign criteria provided, single submitter B:2
• Conservation: PhyloP100: 2.15
• Publications: 0 publications found

Genes affected

MUC7 (HGNC:7518): (mucin 7, secreted) This gene encodes a small salivary mucin, which is thought to play a role in facilitating the clearance of bacteria in the oral cavity and to aid in mastication, speech, and swallowing. The central domain of this glycoprotein contains tandem repeats, each composed of 23 amino acids. This antimicrobial protein has antibacterial and antifungal activity. The most common allele contains 6 repeats, and some alleles may be associated with susceptibility to asthma. Alternatively spliced transcript variants with different 5' UTR, but encoding the same protein, have been found for this gene. [provided by RefSeq, Oct 2014]

ACMG classification

Our verdict: Benign. The variant received -8 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_152291.3.
• BP6: Variant 4-70481421-CATCTTCCTCAGCTCCACCAGAGACCACAGCTGCCCCACCCACACCTTCTGCAACTACACCAGCTCCACT-C is Benign according to our data. Variant chr4-70481421-CATCTTCCTCAGCTCCACCAGAGACCACAGCTGCCCCACCCACACCTTCTGCAACTACACCAGCTCCACT-C is described in ClinVar as Benign. ClinVar VariationId is 777971.Status of the report is criteria_provided_single_submitter, 1 stars.
• BA1: GnomAd4 highest subpopulation (EAS) allele frequency at 95% confidence interval = 0.0629 is higher than 0.05.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_152291.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MUC7	NM_152291.3	MANE Select	c.710_778delCCCCACCCACACCTTCTGCAACTACACCAGCTCCACTATCTTCCTCAGCTCCACCAGAGACCACAGCTG	p.Ala237_Ala259del	disruptive_inframe_deletion	Exon 3 of 3	NP_689504.2	Q8TAX7
	MUC7	NM_001145006.2		c.710_778delCCCCACCCACACCTTCTGCAACTACACCAGCTCCACTATCTTCCTCAGCTCCACCAGAGACCACAGCTG	p.Ala237_Ala259del	disruptive_inframe_deletion	Exon 4 of 4	NP_001138478.1	Q8TAX7
	MUC7	NM_001145007.2		c.710_778delCCCCACCCACACCTTCTGCAACTACACCAGCTCCACTATCTTCCTCAGCTCCACCAGAGACCACAGCTG	p.Ala237_Ala259del	disruptive_inframe_deletion	Exon 4 of 4	NP_001138479.1	Q8TAX7

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MUC7	ENST00000304887.6	TSL:1 MANE Select	c.710_778delCCCCACCCACACCTTCTGCAACTACACCAGCTCCACTATCTTCCTCAGCTCCACCAGAGACCACAGCTG	p.Ala237_Ala259del	disruptive_inframe_deletion	Exon 3 of 3	ENSP00000302021.5	Q8TAX7
	MUC7	ENST00000413702.5	TSL:4	c.710_778delCCCCACCCACACCTTCTGCAACTACACCAGCTCCACTATCTTCCTCAGCTCCACCAGAGACCACAGCTG	p.Ala237_Ala259del	disruptive_inframe_deletion	Exon 4 of 4	ENSP00000407422.1	Q8TAX7
	MUC7	ENST00000456088.5	TSL:4	c.710_778delCCCCACCCACACCTTCTGCAACTACACCAGCTCCACTATCTTCCTCAGCTCCACCAGAGACCACAGCTG	p.Ala237_Ala259del	disruptive_inframe_deletion	Exon 4 of 4	ENSP00000400585.1	Q8TAX7

Frequencies

GnomAD3 genomes AF: 0.0260 AC: 3862 AN: 148472 Hom.: 324 Cov.: 23

Gnomad AFR AF: 0.00968

Gnomad AMI AF: 0.0526

Gnomad AMR AF: 0.0314

Gnomad ASJ AF: 0.0891

Gnomad EAS AF: 0.0689

Gnomad SAS AF: 0.0360

Gnomad FIN AF: 0.0289

Gnomad MID AF: 0.0300

Gnomad NFE AF: 0.0268

Gnomad OTH AF: 0.0278

GnomAD2 exomes AF: 0.0910 AC: 22668 AN: 249082 AF XY: 0.0908

Gnomad AFR exome AF: 0.0216

Gnomad AMR exome AF: 0.128

Gnomad ASJ exome AF: 0.204

Gnomad EAS exome AF: 0.134

Gnomad FIN exome AF: 0.0856

Gnomad NFE exome AF: 0.0722

Gnomad OTH exome AF: 0.0842

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0256 AC: 37175 AN: 1450788 Hom.: 2701 AF XY: 0.0274 AC XY: 19769 AN XY: 720984

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00929 AC: 310 AN: 33358

American (AMR) AF: 0.0418 AC: 1839 AN: 43976

Ashkenazi Jewish (ASJ) AF: 0.0960 AC: 2467 AN: 25688

East Asian (EAS) AF: 0.141 AC: 5508 AN: 39042

South Asian (SAS) AF: 0.0364 AC: 3093 AN: 84988

European-Finnish (FIN) AF: 0.0585 AC: 3103 AN: 53004

Middle Eastern (MID) AF: 0.0536 AC: 304 AN: 5672

European-Non Finnish (NFE) AF: 0.0168 AC: 18540 AN: 1105124

Other (OTH) AF: 0.0336 AC: 2011 AN: 59936

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.0261 AC: 3874 AN: 148582 Hom.: 326 Cov.: 23 AF XY: 0.0269 AC XY: 1947 AN XY: 72506

African (AFR) AF: 0.00982 AC: 396 AN: 40316

American (AMR) AF: 0.0317 AC: 472 AN: 14870

Ashkenazi Jewish (ASJ) AF: 0.0891 AC: 302 AN: 3388

East Asian (EAS) AF: 0.0690 AC: 335 AN: 4854

South Asian (SAS) AF: 0.0362 AC: 165 AN: 4558

European-Finnish (FIN) AF: 0.0289 AC: 293 AN: 10146

Middle Eastern (MID) AF: 0.0321 AC: 9 AN: 280

European-Non Finnish (NFE) AF: 0.0268 AC: 1798 AN: 67204

Other (OTH) AF: 0.0275 AC: 57 AN: 2072

Alfa AF: 0.0914 Hom.: 99

Asia WGS AF: 0.0570 AC: 200 AN: 3478

ClinVar

ClinVar submissions

Significance: Benign

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	-	1	not provided (1)
-	-	-	Asthma, protection against (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.2
Mutation Taster		=199/1	polymorphism (auto)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1560560839; hg19: chr4-71347138;