4-987064-AGTCCCCGAGCACGCGTGGCCATGC-A

Variant names:

• chr4-987064-AGTCCCCGAGCACGCGTGGCCATGC-A
• rs766603377
• NM_000203.5:c.-14_10delGAGCACGCGTGGCCATGCGTCCCC

Variant summary

Our verdict is Pathogenic. The variant received 12 ACMG points: 12P and 0B. PVS1 PS1_Moderate PP5_Moderate

The NM_000203.5(IDUA):​c.-14_10delGAGCACGCGTGGCCATGCGTCCCC​(p.Met1_Leu4del) variant causes a start lost, conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000148 in 1,353,584 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency:
  • Genomes: not found (cov: 33)
  • Exomes 𝑓: 0.0000015 (0 hom.)
• Consequence: IDUA NM_000203.5 start_lost, conservative_inframe_deletion
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: -0.0420
• Publications: 0 publications found

Genes affected

IDUA (HGNC:5391): (alpha-L-iduronidase) This gene encodes an enzyme that hydrolyzes the terminal alpha-L-iduronic acid residues of two glycosaminoglycans, dermatan sulfate and heparan sulfate. This hydrolysis is required for the lysosomal degradation of these glycosaminoglycans. Mutations in this gene that result in enzymatic deficiency lead to the autosomal recessive disease mucopolysaccharidosis type I (MPS I). [provided by RefSeq, Jul 2008]

SLC26A1 (HGNC:10993): (solute carrier family 26 member 1) This gene is a member of a family of sulfate/anion transporter genes. Family members are well conserved in their genomic (number and size of exons) and protein (aa length among species) structures, but have markedly different tissue expression patterns. This gene is primarily expressed in the liver, pancreas, and brain. Three splice variants that encode different isoforms have been identified. [provided by RefSeq, Jul 2008]

DGKQ (HGNC:2856): (diacylglycerol kinase theta) The protein encoded by this gene contains three cysteine-rich domains, a proline-rich region, and a pleckstrin homology domain with an overlapping Ras-associating domain. It is localized in the speckle domains of the nucleus, and mediates the regeneration of phosphatidylinositol (PI) from diacylglycerol in the PI-cycle during cell signal transduction. [provided by RefSeq, Jul 2008]

ACMG classification

Our verdict: Pathogenic. The variant received 12 ACMG points.

• PVS1: Start lost variant, no new inframe start found.
• PS1: Another start lost variant in NM_000203.5 (IDUA) was described as [Pathogenic] in ClinVar as 1323098
• PP5: Variant 4-987064-AGTCCCCGAGCACGCGTGGCCATGC-A is Pathogenic according to our data. Variant chr4-987064-AGTCCCCGAGCACGCGTGGCCATGC-A is described in ClinVar as [Pathogenic]. Clinvar id is 1926190.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
IDUA	NM_000203.5	c.-14_10delGAGCACGCGTGGCCATGCGTCCCC	p.Met1_Leu4del	start_lost, conservative_inframe_deletion	Exon 1 of 14	ENST00000514224.2	NP_000194.2
IDUA	NM_000203.5	c.-14_10delGAGCACGCGTGGCCATGCGTCCCC		5_prime_UTR_variant	Exon 1 of 14	ENST00000514224.2	NP_000194.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
IDUA	ENST00000514224.2	c.-14_10delGAGCACGCGTGGCCATGCGTCCCC	p.Met1_Leu4del	start_lost, conservative_inframe_deletion	Exon 1 of 14	2	NM_000203.5	ENSP00000425081.2
IDUA	ENST00000514224.2	c.-14_10delGAGCACGCGTGGCCATGCGTCCCC		5_prime_UTR_variant	Exon 1 of 14	2	NM_000203.5	ENSP00000425081.2

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome AF: 0.00000148 AC: 2 AN: 1353584 Hom.: 0 AF XY: 0.00000149 AC XY: 1 AN XY: 671460

African (AFR) AF: 0.00 AC: 0 AN: 27492

American (AMR) AF: 0.00 AC: 0 AN: 34554

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 22650

East Asian (EAS) AF: 0.00 AC: 0 AN: 31354

South Asian (SAS) AF: 0.00 AC: 0 AN: 77186

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 34260

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 3828

European-Non Finnish (NFE) AF: 0.00000187 AC: 2 AN: 1067168

Other (OTH) AF: 0.00 AC: 0 AN: 55092

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Mucopolysaccharidosis type 1 Pathogenic:1

Sep 10, 2023

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

For these reasons, this variant has been classified as Pathogenic. ClinVar contains an entry for this variant (Variation ID: 1926190). Disruption of the initiator codon has been observed in individual(s) with mucopolysaccharidosis type I (PMID: 27146977, 31236806). This variant is not present in population databases (gnomAD no frequency). This sequence change affects the initiator methionine of the IDUA mRNA. The next in-frame methionine is located at codon 133. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		-0.042
Mutation Taster		=19/180	disease causing (long InDel)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs766603377; hg19: chr4-980852;