5-119452597-GACGGGCGGGTGGTACTGGTC-G

Variant names:

• chr5-119452597-GACGGGCGGGTGGTACTGGTC-G
• NM_000414.4:c.25_44delGGGCGGGTGGTACTGGTCAC

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_000414.4(HSD17B4):​c.25_44delGGGCGGGTGGTACTGGTCAC​(p.Gly9ArgfsTer25) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. G9G) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 32)
• Consequence: HSD17B4 NM_000414.4 frameshift
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 4.95
• Publications: 0 publications found

Genes affected

HSD17B4 (HGNC:5213): (hydroxysteroid 17-beta dehydrogenase 4) The protein encoded by this gene is a bifunctional enzyme that is involved in the peroxisomal beta-oxidation pathway for fatty acids. It also acts as a catalyst for the formation of 3-ketoacyl-CoA intermediates from both straight-chain and 2-methyl-branched-chain fatty acids. Defects in this gene that affect the peroxisomal fatty acid beta-oxidation activity are a cause of D-bifunctional protein deficiency (DBPD). An apparent pseudogene of this gene is present on chromosome 8. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2014]

HSD17B4 Gene-Disease associations (from GenCC):

• d-bifunctional protein deficiency

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: ClinGen, Myriad Women’s Health, Labcorp Genetics (formerly Invitae), Ambry Genetics, G2P
• Perrault syndrome

  Inheritance: AR Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
• Perrault syndrome 1

  Inheritance: AR Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae), PanelApp Australia

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 188 pathogenic variants in the truncated region.
• PP5: Variant 5-119452597-GACGGGCGGGTGGTACTGGTC-G is Pathogenic according to our data. Variant chr5-119452597-GACGGGCGGGTGGTACTGGTC-G is described in ClinVar as [Likely_pathogenic]. Clinvar id is 2676163.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
HSD17B4	NM_000414.4	c.25_44delGGGCGGGTGGTACTGGTCAC	p.Gly9ArgfsTer25	frameshift_variant	Exon 1 of 24	ENST00000510025.7	NP_000405.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
HSD17B4	ENST00000510025.7	c.25_44delGGGCGGGTGGTACTGGTCAC	p.Gly9ArgfsTer25	frameshift_variant	Exon 1 of 24	2	NM_000414.4	ENSP00000424940.3

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Bifunctional peroxisomal enzyme deficiency Pathogenic:1

Jan 15, 2023

Baylor Genetics

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		5.0

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

hg19: chr5-118788292;