5-140691721-GCTTCGTGCACCGGGGCGGTCCGTTGCC-G

Variant names:

• chr5-140691721-GCTTCGTGCACCGGGGCGGTCCGTTGCC-G
• rs1458185936
• NM_012208.4:c.74_100delCTTCGTGCACCGGGGCGGTCCGTTGCC

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2 PM4

The NM_012208.4(HARS2):​c.74_100delCTTCGTGCACCGGGGCGGTCCGTTGCC​(p.Ala25_Gln34delinsGlu) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000129 in 1,552,494 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: 𝑓 0.000020 (0 hom., cov: 32)
  • Exomes 𝑓: 0.000012 (0 hom.)
• Consequence: HARS2 NM_012208.4 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 1.74

Genes affected

HARS2 (HGNC:4817): (histidyl-tRNA synthetase 2, mitochondrial) Aminoacyl-tRNA synthetases are a class of enzymes that charge tRNAs with their cognate amino acids. The protein encoded by this gene is an enzyme belonging to the class II family of aminoacyl-tRNA synthetases. Functioning in the synthesis of histidyl-transfer RNA, the enzyme plays an accessory role in the regulation of protein biosynthesis. The gene is located in a head-to-head orientation with HARS on chromosome five, where the homologous genes likely share a bidirectional promoter. Mutations in this gene are associated with the pathogenesis of Perrault syndrome, which involves ovarian dysgenesis and sensorineural hearing loss. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]

HARS1 (HGNC:4816): (histidyl-tRNA synthetase 1) Aminoacyl-tRNA synthetases are a class of enzymes that charge tRNAs with their cognate amino acids. The protein encoded by this gene is a cytoplasmic enzyme which belongs to the class II family of aminoacyl-tRNA synthetases. The enzyme is responsible for the synthesis of histidyl-transfer RNA, which is essential for the incorporation of histidine into proteins. The gene is located in a head-to-head orientation with HARSL on chromosome five, where the homologous genes share a bidirectional promoter. The gene product is a frequent target of autoantibodies in the human autoimmune disease polymyositis/dermatomyositis. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_012208.4.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
HARS2	NM_012208.4	c.74_100delCTTCGTGCACCGGGGCGGTCCGTTGCC	p.Ala25_Gln34delinsGlu	disruptive_inframe_deletion	Exon 1 of 13	ENST00000230771.9	NP_036340.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
HARS2	ENST00000230771.9	c.74_100delCTTCGTGCACCGGGGCGGTCCGTTGCC	p.Ala25_Gln34delinsGlu	disruptive_inframe_deletion	Exon 1 of 13	1	NM_012208.4	ENSP00000230771.3

Frequencies

GnomAD3 genomes AF: 0.0000197 AC: 3 AN: 152236 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000441

Gnomad OTH AF: 0.00

GnomAD3 exomes AF: 0.0000322 AC: 5 AN: 155054 Hom.: 0 AF XY: 0.0000483 AC XY: 4 AN XY: 82862

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000837

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.0000121 AC: 17 AN: 1400258 Hom.: 0 AF XY: 0.0000130 AC XY: 9 AN XY: 690946

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.0000157

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome AF: 0.0000197 AC: 3 AN: 152236 Hom.: 0 Cov.: 32 AF XY: 0.0000269 AC XY: 2 AN XY: 74376

Gnomad4 AFR AF: 0.00

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000441

Gnomad4 OTH AF: 0.00

Bravo AF: 0.0000151

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Uncertain:1

Sep 15, 2022

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.74_100del, is a complex sequence change that results in the deletion of 10 and insertion of 1 amino acid(s) in the HARS2 protein (p.Ala25_Gln34delinsGlu). This variant is present in population databases (no rsID available, gnomAD 0.007%). This variant has not been reported in the literature in individuals affected with HARS2-related conditions. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1458185936; hg19: chr5-140071306;