5-14664886-CCGGCGCGGGAGGCGGCGGCCA-C

Variant names:

• chr5-14664886-CCGGCGCGGGAGGCGGCGGCCA-C
• rs199656228
• NM_138348.6:c.72_92delGGCGGCGGCCACGGCGCGGGA

Variant summary

Our verdict is Benign. The variant received -8 ACMG points: 2P and 10B. PM4 BP6_Moderate BA1

The NM_138348.6(OTULIN):​c.72_92delGGCGGCGGCCACGGCGCGGGA​(p.Glu24_Arg30del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0075 in 1,190,212 control chromosomes in the GnomAD database, including 330 homozygotes. Variant has been reported in ClinVar as Benign (★).

• Frequency:
  • Genomes: 𝑓 0.029 (170 hom., cov: 34)
  • Exomes 𝑓: 0.0044 (160 hom.)
• Consequence: OTULIN NM_138348.6 disruptive_inframe_deletion
• Clinical Significance: Benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 2.13

Genes affected

OTULIN (HGNC:25118): (OTU deubiquitinase with linear linkage specificity) This gene encodes a member of the peptidase C65 family of ubiquitin isopeptidases. Members of this family remove ubiquitin from proteins. The encoded enzyme specifically recognizes and removes M1(Met1)-linked, or linear, ubiquitin chains from protein substrates. Linear ubiquitin chains are known to regulate the NF-kappa B signaling pathway in the context of immunity and inflammation. Mutations in this gene cause a potentially fatal autoinflammatory syndrome in human patients. [provided by RefSeq, Sep 2016]

ACMG classification

Our verdict: Benign. The variant received -8 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_138348.6.
• BP6: Variant 5-14664886-CCGGCGCGGGAGGCGGCGGCCA-C is Benign according to our data. Variant chr5-14664886-CCGGCGCGGGAGGCGGCGGCCA-C is described in ClinVar as [Benign]. Clinvar id is 1165553.Status of the report is criteria_provided_single_submitter, 1 stars.
• BA1: GnomAd4 highest subpopulation (AFR) allele frequency at 95% confidence interval = 0.0909 is higher than 0.05.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
OTULIN	NM_138348.6	c.72_92delGGCGGCGGCCACGGCGCGGGA	p.Glu24_Arg30del	disruptive_inframe_deletion	Exon 1 of 7	ENST00000284274.5	NP_612357.4

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
OTULIN	ENST00000284274.5	c.72_92delGGCGGCGGCCACGGCGCGGGA	p.Glu24_Arg30del	disruptive_inframe_deletion	Exon 1 of 7	1	NM_138348.6	ENSP00000284274.4
OTULIN	ENST00000503023.2	n.72_92delGGCGGCGGCCACGGCGCGGGA		non_coding_transcript_exon_variant	Exon 1 of 6	5		ENSP00000427016.1
OTULIN	ENST00000507335.1	n.166_186delGGCGGCGGCCACGGCGCGGGA		non_coding_transcript_exon_variant	Exon 1 of 2	2
OTULIN	ENST00000697367.1	n.72_92delGGCGGCGGCCACGGCGCGGGA		non_coding_transcript_exon_variant	Exon 1 of 5			ENSP00000513279.1

Frequencies

GnomAD3 genomes AF: 0.0286 AC: 4314 AN: 151006 Hom.: 169 Cov.: 34

Gnomad AFR AF: 0.0934

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0111

Gnomad ASJ AF: 0.00202

Gnomad EAS AF: 0.000772

Gnomad SAS AF: 0.0169

Gnomad FIN AF: 0.0000991

Gnomad MID AF: 0.00637

Gnomad NFE AF: 0.00216

Gnomad OTH AF: 0.0227

GnomAD2 exomes AF: 0.00285 AC: 6 AN: 2102 AF XY: 0.00

Gnomad AFR exome AF: 0.0455

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.0714

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.00443 AC: 4601 AN: 1039098 Hom.: 160 AF XY: 0.00425 AC XY: 2084 AN XY: 490630

Gnomad4 AFR exome AF: 0.111 AC: 2384 AN: 21420

Gnomad4 AMR exome AF: 0.00771 AC: 55 AN: 7138

Gnomad4 ASJ exome AF: 0.00261 AC: 32 AN: 12244

Gnomad4 EAS exome AF: 0.00124 AC: 28 AN: 22542

Gnomad4 SAS exome AF: 0.0157 AC: 303 AN: 19318

Gnomad4 FIN exome AF: 0.000413 AC: 8 AN: 19370

Gnomad4 NFE exome AF: 0.00151 AC: 1352 AN: 894020

Gnomad4 Remaining exome AF: 0.00976 AC: 394 AN: 40364

GnomAD4 genome AF: 0.0286 AC: 4325 AN: 151114 Hom.: 170 Cov.: 34 AF XY: 0.0272 AC XY: 2011 AN XY: 73850

Gnomad4 AFR AF: 0.0934 AC: 0.0933923 AN: 0.0933923

Gnomad4 AMR AF: 0.0111 AC: 0.0110789 AN: 0.0110789

Gnomad4 ASJ AF: 0.00202 AC: 0.00202312 AN: 0.00202312

Gnomad4 EAS AF: 0.000774 AC: 0.000774293 AN: 0.000774293

Gnomad4 SAS AF: 0.0174 AC: 0.0173769 AN: 0.0173769

Gnomad4 FIN AF: 0.0000991 AC: 0.0000990884 AN: 0.0000990884

Gnomad4 NFE AF: 0.00214 AC: 0.00214199 AN: 0.00214199

Gnomad4 OTH AF: 0.0224 AC: 0.0224451 AN: 0.0224451

Alfa AF: 0.0168 Hom.: 10

Asia WGS AF: 0.0130 AC: 44 AN: 3430

ClinVar

Significance: Benign

Submissions summary: Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Benign:1

Feb 03, 2025

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
Mutation Taster		=167/33	polymorphism (auto)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs199656228; hg19: chr5-14664995; COSMIC: COSV104370616; COSMIC: COSV104370616;