5-146878727-A-AGCTGCTGCTGCTGCTGCTGCT

Variant names:

• chr5-146878727-A-AGCTGCTGCTGCTGCTGCTGCT
• rs10591869
• ENST00000530902.5:n.147_167dupAGCAGCAGCAGCAGCAGCAGC

Variant summary

Our verdict is Benign. The variant received -16 ACMG points: 0P and 16B. BP6_Very_Strong BA1

The ENST00000530902.5(PPP2R2B):​n.147_167dupAGCAGCAGCAGCAGCAGCAGC variant causes a non coding transcript exon change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★★).

• Frequency:
  • Genomes: 𝑓 0.013 (23 hom., cov: 0)
  • Exomes 𝑓: 0.012 (992 hom.)
  • Failed GnomAD Quality Control
• Consequence: PPP2R2B ENST00000530902.5 non_coding_transcript_exon
• Clinical Significance: Likely benign criteria provided, multiple submitters, no conflicts B:2
• Conservation: PhyloP100: 3.19
• Publications: 4 publications found

Genes affected

PPP2R2B (HGNC:9305): (protein phosphatase 2 regulatory subunit Bbeta) The product of this gene belongs to the phosphatase 2 regulatory subunit B family. Protein phosphatase 2 is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes a beta isoform of the regulatory subunit B55 subfamily. Defects in this gene cause autosomal dominant spinocerebellar ataxia 12 (SCA12), a disease caused by degeneration of the cerebellum, sometimes involving the brainstem and spinal cord, and in resulting in poor coordination of speech and body movements. Multiple alternatively spliced variants, which encode different isoforms, have been identified for this gene. The 5' UTR of some of these variants includes a CAG trinucleotide repeat sequence (7-28 copies) that can be expanded to 55-78 copies in cases of SCA12. [provided by RefSeq, Jul 2016]

PPP2R2B Gene-Disease associations (from GenCC):

• spinocerebellar ataxia type 12

  Inheritance: AD Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Ambry Genetics, Orphanet, Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Benign. The variant received -16 ACMG points.

• BP6: Variant 5-146878727-A-AGCTGCTGCTGCTGCTGCTGCT is Benign according to our data. Variant chr5-146878727-A-AGCTGCTGCTGCTGCTGCTGCT is described in ClinVar as [Likely_benign]. Clinvar id is 445389.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BA1: GnomAd4 highest subpopulation (EAS) allele frequency at 95% confidence interval = 0.0601 is higher than 0.05.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
PPP2R2B	NM_181675.4	c.-282_-262dupAGCAGCAGCAGCAGCAGCAGC		5_prime_UTR_variant	Exon 1 of 10	ENST00000394411.9	NP_858061.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
PPP2R2B	ENST00000394411.9	c.-282_-262dupAGCAGCAGCAGCAGCAGCAGC		5_prime_UTR_variant	Exon 1 of 10	2	NM_181675.4	ENSP00000377933.3

Frequencies

GnomAD3 genomes AF: 0.0130 AC: 1956 AN: 150474 Hom.: 24 Cov.: 0

Gnomad AFR AF: 0.0184

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0106

Gnomad ASJ AF: 0.00231

Gnomad EAS AF: 0.0667

Gnomad SAS AF: 0.0319

Gnomad FIN AF: 0.00354

Gnomad MID AF: 0.00962

Gnomad NFE AF: 0.00719

Gnomad OTH AF: 0.0155

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0121 AC: 13807 AN: 1144524 Hom.: 992 Cov.: 27 AF XY: 0.0130 AC XY: 7299 AN XY: 560826

African (AFR) AF: 0.0227 AC: 530 AN: 23378

American (AMR) AF: 0.0206 AC: 558 AN: 27120

Ashkenazi Jewish (ASJ) AF: 0.00361 AC: 55 AN: 15242

East Asian (EAS) AF: 0.109 AC: 2538 AN: 23332

South Asian (SAS) AF: 0.0369 AC: 2668 AN: 72288

European-Finnish (FIN) AF: 0.0128 AC: 198 AN: 15428

Middle Eastern (MID) AF: 0.0296 AC: 84 AN: 2840

European-Non Finnish (NFE) AF: 0.00698 AC: 6441 AN: 922126

Other (OTH) AF: 0.0172 AC: 735 AN: 42770

GnomAD4 genome AF: 0.0129 AC: 1949 AN: 150592 Hom.: 23 Cov.: 0 AF XY: 0.0126 AC XY: 923 AN XY: 73472

African (AFR) AF: 0.0183 AC: 752 AN: 41000

American (AMR) AF: 0.0105 AC: 159 AN: 15176

Ashkenazi Jewish (ASJ) AF: 0.00231 AC: 8 AN: 3460

East Asian (EAS) AF: 0.0660 AC: 324 AN: 4906

South Asian (SAS) AF: 0.0317 AC: 149 AN: 4698

European-Finnish (FIN) AF: 0.00354 AC: 37 AN: 10442

Middle Eastern (MID) AF: 0.0103 AC: 3 AN: 290

European-Non Finnish (NFE) AF: 0.00719 AC: 486 AN: 67630

Other (OTH) AF: 0.0148 AC: 31 AN: 2088

Alfa AF: 0.00 Hom.: 47

ClinVar

Significance: Likely benign

Submissions summary: Benign:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not specified Benign:1

Feb 16, 2025

Laboratory of Genetics, Children's Clinical University Hospital Latvia

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

not provided Benign:1

Feb 23, 2017

Center for Pediatric Genomic Medicine, Children's Mercy Hospital and Clinics

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.2
Mutation Taster		=100/0	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs10591869; hg19: chr5-146258290;