5-146878727-AGCTGCTGCTGCTGCTGCTGCTGCT-AGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT

Variant names:

• chr5-146878727-A-AGCTGCTGCTGCTGCTGCTGCTGCT
• rs10591869
• ENST00000530902.5:n.144_167dupAGCAGCAGCAGCAGCAGCAGCAGC

Variant summary

Our verdict is Benign. The variant received -9 ACMG points: 0P and 9B. BP6 BS1 BS2

The ENST00000530902.5(PPP2R2B):​n.144_167dupAGCAGCAGCAGCAGCAGCAGCAGC variant causes a non coding transcript exon change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Benign (no stars).

• Frequency:
  • Genomes: 𝑓 0.015 (31 hom., cov: 0)
  • Exomes 𝑓: 0.017 (1024 hom.)
  • Failed GnomAD Quality Control
• Consequence: PPP2R2B ENST00000530902.5 non_coding_transcript_exon
• Clinical Significance: Benign no assertion criteria provided B:1
• Conservation: PhyloP100: 3.19
• Publications: 4 publications found

Genes affected

PPP2R2B (HGNC:9305): (protein phosphatase 2 regulatory subunit Bbeta) The product of this gene belongs to the phosphatase 2 regulatory subunit B family. Protein phosphatase 2 is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes a beta isoform of the regulatory subunit B55 subfamily. Defects in this gene cause autosomal dominant spinocerebellar ataxia 12 (SCA12), a disease caused by degeneration of the cerebellum, sometimes involving the brainstem and spinal cord, and in resulting in poor coordination of speech and body movements. Multiple alternatively spliced variants, which encode different isoforms, have been identified for this gene. The 5' UTR of some of these variants includes a CAG trinucleotide repeat sequence (7-28 copies) that can be expanded to 55-78 copies in cases of SCA12. [provided by RefSeq, Jul 2016]

PPP2R2B Gene-Disease associations (from GenCC):

• spinocerebellar ataxia type 12

  Inheritance: AD Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Ambry Genetics, Orphanet, Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Benign. The variant received -9 ACMG points.

• BP6: Variant 5-146878727-A-AGCTGCTGCTGCTGCTGCTGCTGCT is Benign according to our data. Variant chr5-146878727-A-AGCTGCTGCTGCTGCTGCTGCTGCT is described in ClinVar as [Benign]. Clinvar id is 3037533.Status of the report is no_assertion_criteria_provided, 0 stars.
• BS1: Variant frequency is greater than expected in population eas. GnomAd4 allele frequency = 0.0148 (2225/150590) while in subpopulation EAS AF = 0.0407 (200/4910). AF 95% confidence interval is 0.0361. There are 31 homozygotes in GnomAd4. There are 1106 alleles in the male GnomAd4 subpopulation. Median coverage is 0. This position passed quality control check.
• BS2: High AC in GnomAd4 at 2225 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
PPP2R2B	NM_181675.4	c.-285_-262dupAGCAGCAGCAGCAGCAGCAGCAGC		5_prime_UTR_variant	Exon 1 of 10	ENST00000394411.9	NP_858061.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
PPP2R2B	ENST00000394411.9	c.-285_-262dupAGCAGCAGCAGCAGCAGCAGCAGC		5_prime_UTR_variant	Exon 1 of 10	2	NM_181675.4	ENSP00000377933.3

Frequencies

GnomAD3 genomes AF: 0.0148 AC: 2223 AN: 150472 Hom.: 31 Cov.: 0

Gnomad AFR AF: 0.0178

Gnomad AMI AF: 0.0244

Gnomad AMR AF: 0.00666

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.0410

Gnomad SAS AF: 0.0387

Gnomad FIN AF: 0.0144

Gnomad MID AF: 0.00641

Gnomad NFE AF: 0.0120

Gnomad OTH AF: 0.0106

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0170 AC: 19423 AN: 1143590 Hom.: 1024 Cov.: 27 AF XY: 0.0180 AC XY: 10075 AN XY: 560504

African (AFR) AF: 0.0298 AC: 694 AN: 23326

American (AMR) AF: 0.00800 AC: 217 AN: 27140

Ashkenazi Jewish (ASJ) AF: 0.00112 AC: 17 AN: 15238

East Asian (EAS) AF: 0.0705 AC: 1671 AN: 23690

South Asian (SAS) AF: 0.0396 AC: 2863 AN: 72354

European-Finnish (FIN) AF: 0.0340 AC: 528 AN: 15530

Middle Eastern (MID) AF: 0.00669 AC: 19 AN: 2842

European-Non Finnish (NFE) AF: 0.0137 AC: 12603 AN: 920674

Other (OTH) AF: 0.0190 AC: 811 AN: 42796

GnomAD4 genome AF: 0.0148 AC: 2225 AN: 150590 Hom.: 31 Cov.: 0 AF XY: 0.0151 AC XY: 1106 AN XY: 73470

African (AFR) AF: 0.0178 AC: 731 AN: 40998

American (AMR) AF: 0.00666 AC: 101 AN: 15176

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3458

East Asian (EAS) AF: 0.0407 AC: 200 AN: 4910

South Asian (SAS) AF: 0.0387 AC: 182 AN: 4698

European-Finnish (FIN) AF: 0.0144 AC: 150 AN: 10440

Middle Eastern (MID) AF: 0.00690 AC: 2 AN: 290

European-Non Finnish (NFE) AF: 0.0121 AC: 815 AN: 67630

Other (OTH) AF: 0.0105 AC: 22 AN: 2088

Alfa AF: 0.00 Hom.: 47

ClinVar

Significance: Benign

Submissions summary: Benign:1

Revision: no assertion criteria provided

Submissions by phenotype

PPP2R2B-related disorder Benign:1

Feb 25, 2020

PreventionGenetics, part of Exact Sciences

Significance: Benign

Review Status: no assertion criteria provided

Collection Method: clinical testing

This variant is classified as benign based on ACMG/AMP sequence variant interpretation guidelines (Richards et al. 2015 PMID: 25741868, with internal and published modifications). -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.2
Mutation Taster		=100/0	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs10591869; hg19: chr5-146258290;