5-146878727-AGCTGCTGCTGCTGCTGCTGCTGCT-AGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT

Position:

• chr5-146878727-AGCTGCTGCTGCTGCTGCTGCTGCT-AGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT

Variant summary

Our verdict is Uncertain significance. Variant got 0 ACMG points: 0P and 0B.

The NM_181675.4(PPP2R2B):​c.-262_-261insAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC variant causes a 5 prime UTR change involving the alteration of a non-conserved nucleotide. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.0000066 (0 hom., cov: 0)
  • Exomes 𝑓: 0.000011 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: PPP2R2B NM_181675.4 5_prime_UTR
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 3.19

Genes affected

PPP2R2B (HGNC:9305): (protein phosphatase 2 regulatory subunit Bbeta) The product of this gene belongs to the phosphatase 2 regulatory subunit B family. Protein phosphatase 2 is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes a beta isoform of the regulatory subunit B55 subfamily. Defects in this gene cause autosomal dominant spinocerebellar ataxia 12 (SCA12), a disease caused by degeneration of the cerebellum, sometimes involving the brainstem and spinal cord, and in resulting in poor coordination of speech and body movements. Multiple alternatively spliced variants, which encode different isoforms, have been identified for this gene. The 5' UTR of some of these variants includes a CAG trinucleotide repeat sequence (7-28 copies) that can be expanded to 55-78 copies in cases of SCA12. [provided by RefSeq, Jul 2016]

ACMG classification

Verdict is Uncertain_significance. Variant got 0 ACMG points.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
PPP2R2B	NM_181675.4	c.-262_-261insAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC		5_prime_UTR_variant	1/10	ENST00000394411.9	NP_858061.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
PPP2R2B	ENST00000394411.9	c.-262_-261insAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC		5_prime_UTR_variant	1/10	2	NM_181675.4	ENSP00000377933	P3

Frequencies

GnomAD3 genomes AF: 0.00000665 AC: 1 AN: 150486 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000148

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000113 AC: 13 AN: 1147000 Hom.: 0 Cov.: 27 AF XY: 0.0000142 AC XY: 8 AN XY: 562108

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.000210

Gnomad4 SAS exome AF: 0.0000689

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000325

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome AF: 0.00000665 AC: 1 AN: 150486 Hom.: 0 Cov.: 0 AF XY: 0.0000136 AC XY: 1 AN XY: 73344

Gnomad4 AFR AF: 0.00

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000148

Gnomad4 OTH AF: 0.00

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs10591869; hg19: chr5-146258290;