5-168431457-TCTGGCTGGCTGGCTGGCTGGCTGGCTGGCTGG-TCTGGCTGGCTGG

Variant names:

• chr5-168431457-TCTGGCTGGCTGGCTGGCTGG-T
• rs11279828
• NM_015238.3:c.2280+41_2280+60delGCTGGCTGGCTGGCTGGCTG

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The NM_015238.3(WWC1):​c.2280+41_2280+60delGCTGGCTGGCTGGCTGGCTG variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000153 in 1,414,544 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.00012 (0 hom., cov: 0)
  • Exomes 𝑓: 0.00016 (0 hom.)
• Consequence: WWC1 NM_015238.3 intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 2.31
• Publications: 2 publications found

Genes affected

WWC1 (HGNC:29435): (WW and C2 domain containing 1) The protein encoded by this gene is a cytoplasmic phosphoprotein that interacts with PRKC-zeta and dynein light chain-1. Alleles of this gene have been found that enhance memory in some individuals. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
WWC1	NM_015238.3	c.2280+41_2280+60delGCTGGCTGGCTGGCTGGCTG		intron_variant	Intron 15 of 22	ENST00000265293.9	NP_056053.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
WWC1	ENST00000265293.9	c.2280+14_2280+33delCTGGCTGGCTGGCTGGCTGG		intron_variant	Intron 15 of 22	1	NM_015238.3	ENSP00000265293.4

Frequencies

GnomAD3 genomes AF: 0.000121 AC: 18 AN: 148352 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.0000996

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000135

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.0000984

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000164

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.000157 AC: 199 AN: 1266082 Hom.: 0 AF XY: 0.000138 AC XY: 87 AN XY: 628350

African (AFR) AF: 0.000383 AC: 11 AN: 28758

American (AMR) AF: 0.000557 AC: 18 AN: 32320

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 20520

East Asian (EAS) AF: 0.000194 AC: 7 AN: 36082

South Asian (SAS) AF: 0.000158 AC: 11 AN: 69526

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 35626

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 4682

European-Non Finnish (NFE) AF: 0.000147 AC: 145 AN: 985252

Other (OTH) AF: 0.000131 AC: 7 AN: 53316

GnomAD4 genome AF: 0.000121 AC: 18 AN: 148462 Hom.: 0 Cov.: 0 AF XY: 0.000111 AC XY: 8 AN XY: 72194

African (AFR) AF: 0.0000993 AC: 4 AN: 40280

American (AMR) AF: 0.000134 AC: 2 AN: 14876

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3430

East Asian (EAS) AF: 0.00 AC: 0 AN: 4972

South Asian (SAS) AF: 0.00 AC: 0 AN: 4420

European-Finnish (FIN) AF: 0.0000984 AC: 1 AN: 10164

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 290

European-Non Finnish (NFE) AF: 0.000164 AC: 11 AN: 67104

Other (OTH) AF: 0.00 AC: 0 AN: 2024

Alfa AF: 0.000298 Hom.: 1588

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs11279828; hg19: chr5-167858462;