5-179345228-GGCGGCGGCGGCGGCGGCAGGA-GGCGGCGGCGGCGGCGGCAGGAGCGGCGGCGGCGGCGGCAGGA

Variant names:

• chr5-179345228-G-GGCGGCGGCGGCGGCGGCAGGA
• rs1064794627
• NM_014244.5:c.80_100dupTCCTGCCGCCGCCGCCGCCGC

Variant summary

Our verdict is Benign. Variant got -17 ACMG points: 0P and 17B. BP3 BP6_Very_Strong BS1 BS2

The NM_014244.5(ADAMTS2):​c.80_100dupTCCTGCCGCCGCCGCCGCCGC​(p.Leu27_Pro33dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00538 in 147,388 control chromosomes in the GnomAD database, including 3 homozygotes. Variant has been reported in ClinVar as Likely benign (★★).

• Frequency:
  • Genomes: 𝑓 0.0054 (3 hom., cov: 33)
  • Exomes 𝑓: 0.0025 (7 hom.)
  • Failed GnomAD Quality Control
• Consequence: ADAMTS2 NM_014244.5 conservative_inframe_insertion
• Clinical Significance: Benign/Likely benign criteria provided, multiple submitters, no conflicts B:6
• Conservation: PhyloP100: 3.24

Genes affected

ADAMTS2 (HGNC:218): (ADAM metallopeptidase with thrombospondin type 1 motif 2) This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature procollagen N-proteinase. This proteinase excises the N-propeptide of the fibrillar procollagens types I-III and type V. Mutations in this gene cause Ehlers-Danlos syndrome type VIIC, a recessively inherited connective-tissue disorder. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Feb 2016]

ACMG classification

Verdict is Benign. Variant got -17 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_014244.5
• BP6: Variant 5-179345228-G-GGCGGCGGCGGCGGCGGCAGGA is Benign according to our data. Variant chr5-179345228-G-GGCGGCGGCGGCGGCGGCAGGA is described in ClinVar as [Likely_benign]. Clinvar id is 420673.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BS1: Variant frequency is greater than expected in population nfe. gnomad4 allele frequency = 0.00538 (793/147388) while in subpopulation NFE AF= 0.00744 (495/66540). AF 95% confidence interval is 0.0069. There are 3 homozygotes in gnomad4. There are 364 alleles in male gnomad4 subpopulation. Median coverage is 33. This position pass quality control queck.
• BS2: High Homozygotes in GnomAd4 at 3 AR gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ADAMTS2	NM_014244.5	c.80_100dupTCCTGCCGCCGCCGCCGCCGC	p.Leu27_Pro33dup	conservative_inframe_insertion	Exon 1 of 22	ENST00000251582.12	NP_055059.2
ADAMTS2	NM_021599.4	c.80_100dupTCCTGCCGCCGCCGCCGCCGC	p.Leu27_Pro33dup	conservative_inframe_insertion	Exon 1 of 11		NP_067610.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ADAMTS2	ENST00000251582.12	c.80_100dupTCCTGCCGCCGCCGCCGCCGC	p.Leu27_Pro33dup	conservative_inframe_insertion	Exon 1 of 22	1	NM_014244.5	ENSP00000251582.7
ADAMTS2	ENST00000274609.5	c.80_100dupTCCTGCCGCCGCCGCCGCCGC	p.Leu27_Pro33dup	conservative_inframe_insertion	Exon 1 of 11	1		ENSP00000274609.5
ADAMTS2	ENST00000518335.3	c.80_100dupTCCTGCCGCCGCCGCCGCCGC	p.Leu27_Pro33dup	conservative_inframe_insertion	Exon 1 of 21	3		ENSP00000489888.2
ADAMTS2	ENST00000698889.1	n.80_100dupTCCTGCCGCCGCCGCCGCCGC		non_coding_transcript_exon_variant	Exon 1 of 21			ENSP00000514008.1

Frequencies

GnomAD3 genomes AF: 0.00538 AC: 793 AN: 147288 Hom.: 3 Cov.: 33

Gnomad AFR AF: 0.00167

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00658

Gnomad ASJ AF: 0.0205

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00106

Gnomad FIN AF: 0.00442

Gnomad MID AF: 0.00649

Gnomad NFE AF: 0.00744

Gnomad OTH AF: 0.00740

GnomAD3 exomes AF: 0.00683 AC: 5 AN: 732 Hom.: 0 AF XY: 0.00242 AC XY: 1 AN XY: 414

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00760

Gnomad OTH exome AF: 0.0714

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00250 AC: 2318 AN: 928860 Hom.: 7 Cov.: 30 AF XY: 0.00246 AC XY: 1090 AN XY: 442302

Gnomad4 AFR exome AF: 0.000607

Gnomad4 AMR exome AF: 0.00132

Gnomad4 ASJ exome AF: 0.00474

Gnomad4 EAS exome AF: 0.0000787

Gnomad4 SAS exome AF: 0.000834

Gnomad4 FIN exome AF: 0.000484

Gnomad4 NFE exome AF: 0.00263

Gnomad4 OTH exome AF: 0.00236

GnomAD4 genome AF: 0.00538 AC: 793 AN: 147388 Hom.: 3 Cov.: 33 AF XY: 0.00507 AC XY: 364 AN XY: 71848

Gnomad4 AFR AF: 0.00166

Gnomad4 AMR AF: 0.00657

Gnomad4 ASJ AF: 0.0205

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00106

Gnomad4 FIN AF: 0.00442

Gnomad4 NFE AF: 0.00744

Gnomad4 OTH AF: 0.00732

ClinVar

Significance: Benign/Likely benign

Submissions summary: Benign:6

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Ehlers-Danlos syndrome, dermatosparaxis type Benign:2

Apr 20, 2020

Natera, Inc.

Significance: Likely benign

Review Status: no assertion criteria provided

Collection Method: clinical testing

- -

Feb 03, 2025

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

not provided Benign:2

Apr 10, 2024

GeneDx

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

See Variant Classification Assertion Criteria. -

Jan 01, 2023

CeGaT Center for Human Genetics Tuebingen

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

ADAMTS2: BS2 -

not specified Benign:1

Apr 10, 2019

Women's Health and Genetics/Laboratory Corporation of America, LabCorp

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Variant summary: ADAMTS2 c.80_100dup21 (p.Leu27_Pro33dup) results in an in-frame duplication of 7 amino acids into the encoded protein. The variant allele was found at a frequency of 0.0044 in 27980 control chromosomes. The observed variant frequency is approximately 1.5 fold of the estimated maximal expected allele frequency for a pathogenic variant in ADAMTS2 causing Ehlers-Danlos Syndrome, Type VIIC (Dermatosparaxis) phenotype (0.0029), strongly suggesting that the variant is benign. Three clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar after 2014 without evidence for independent evaluation (2x VUS, 1x Benign). Based on the evidence outlined above, the variant was classified as benign. -

Ehlers-Danlos syndrome Benign:1

Mar 15, 2022

Genome Diagnostics Laboratory, The Hospital for Sick Children

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1064794627; hg19: chr5-178772229;