5-179821121-G-C

Variant names:

• chr5-179821121-G-C
• rs774355338
• NM_003900.5:c.185G>C

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 4P and 2B. PM2 PM5 BP4_Moderate

The NM_003900.5(SQSTM1):​c.185G>C​(p.Gly62Ala) variant causes a missense change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000245 in 1,222,918 control chromosomes in the GnomAD database, with no homozygous occurrence. In-silico tool predicts a benign outcome for this variant. 14/22 in silico tools predict a benign outcome for this variant. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Another variant affecting the same amino acid position, but resulting in a different missense (i.e. G62V) has been classified as Likely benign.

• Frequency:
  • Genomes: not found (cov: 34)
  • Exomes 𝑓: 0.0000025 (0 hom.)
• Consequence: SQSTM1 NM_003900.5 missense
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 1.82
• Publications: 0 publications found

Genes affected

SQSTM1 (HGNC:11280): (sequestosome 1) This gene encodes a multifunctional protein that binds ubiquitin and regulates activation of the nuclear factor kappa-B (NF-kB) signaling pathway. The protein functions as a scaffolding/adaptor protein in concert with TNF receptor-associated factor 6 to mediate activation of NF-kB in response to upstream signals. Alternatively spliced transcript variants encoding either the same or different isoforms have been identified for this gene. Mutations in this gene result in sporadic and familial Paget disease of bone. [provided by RefSeq, Mar 2009]

SQSTM1 Gene-Disease associations (from GenCC):

• neurodegeneration with ataxia, dystonia, and gaze palsy, childhood-onset

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), Illumina
• frontotemporal dementia and/or amyotrophic lateral sclerosis 3

  Inheritance: AD Classification: STRONG, MODERATE Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp, ClinGen
• osteosarcoma

  Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
• Paget disease of bone 3

  Inheritance: AD Classification: STRONG, LIMITED Submitted by: G2P, Genomics England PanelApp, Labcorp Genetics (formerly Invitae)
• amyotrophic lateral sclerosis

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• behavioral variant of frontotemporal dementia

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• frontotemporal dementia with motor neuron disease

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ENSG00000301422 (HGNC:):

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM5: Other missense variant is known to change same aminoacid residue: Variant chr5-179821121-GCTTCCAGGCGCACTACCGCGGTGAGCGGGCCGGGGAGCGGCGGGGGCGGTGACGCAGGCCGGACACGG-CACTACAGAGGTCCTGGTCTGTGCGGGGGCCTCCAGGCCTTCTGCGCTGCAGCCACTGCGCTGTGTCCCCTGTGATTGTCAATCTCCCTAAAGATGGCCCAGAGCAGTGCGGCCTGAATC is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 2942752.Status of the report is criteria_provided_single_submitter, 1 stars.
• BP4: Computational evidence support a benign effect (MetaRNN=0.13471693).

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_003900.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SQSTM1	NM_003900.5	MANE Select	c.185G>C	p.Gly62Ala	missense	Exon 1 of 8	NP_003891.1
	SQSTM1	NM_001142298.2		c.-47-1837G>C		intron	N/A	NP_001135770.1
	SQSTM1	NM_001142299.2		c.-47-1837G>C		intron	N/A	NP_001135771.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SQSTM1	ENST00000389805.9	TSL:1 MANE Select	c.185G>C	p.Gly62Ala	missense	Exon 1 of 8	ENSP00000374455.4
	SQSTM1	ENST00000510187.5	TSL:5	c.185G>C	p.Gly62Ala	missense	Exon 1 of 7	ENSP00000424477.1
	SQSTM1	ENST00000504627.1	TSL:5	c.185G>C	p.Gly62Ala	missense	Exon 1 of 3	ENSP00000425957.1

Frequencies

GnomAD3 genomes Cov.: 34

GnomAD4 exome AF: 0.00000245 AC: 3 AN: 1222918 Hom.: 0 Cov.: 31 AF XY: 0.00000505 AC XY: 3 AN XY: 593636

African (AFR) AF: 0.00 AC: 0 AN: 24462

American (AMR) AF: 0.00 AC: 0 AN: 13188

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 18092

East Asian (EAS) AF: 0.00 AC: 0 AN: 27122

South Asian (SAS) AF: 0.0000541 AC: 3 AN: 55492

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 30138

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 3594

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 1000494

Other (OTH) AF: 0.00 AC: 0 AN: 50336

GnomAD4 genome Cov.: 34

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
AlphaMissense	Benign	0.089
BayesDel_addAF	Benign	-0.24	T
BayesDel_noAF	Benign	-0.58
CADD	Benign	20
DANN	Benign	0.87
DEOGEN2	Benign	0.10	T
Eigen	Benign	-0.57
Eigen_PC	Benign	-0.40
FATHMM_MKL	Benign	0.32	N
LIST_S2	Benign	0.73	T
M_CAP	Uncertain	0.26	D
MetaRNN	Benign	0.13	T
MetaSVM	Benign	-1.1	T
MutationAssessor	Benign	0.46	N
PhyloP100		1.8
PrimateAI	Pathogenic	0.85	D
PROVEAN	Benign	-0.97	N
REVEL	Benign	0.036
Sift	Benign	0.76	T
Sift4G	Benign	1.0	T
Polyphen		0.048	B
Vest4		0.30
MutPred		0.44		Gain of loop (P = 0.1069)
MVP		0.77
MPC		0.14
ClinPred		0.11	T
GERP RS		2.5
PromoterAI		-0.029	Neutral
Varity_R		0.18
gMVP		0.26
Mutation Taster		=69/31	polymorphism

Splicing

Name	Calibrated prediction	Score	Prediction
SpliceAI score (max)		0.0		Details are displayed if max score is > 0.2

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs774355338; hg19: chr5-179248121;