5-80654704-CCGGGCTGCCATCCTTGCCCTGCCATGTCTCGCCGGAAGCCTGCGT-C

Variant summary

Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PVS1PM2

The NM_002439.5(MSH3):​c.-18_27delTGCCATCCTTGCCCTGCCATGTCTCGCCGGAAGCCTGCGTCGGGC​(p.Met1_Gly9del) variant causes a start lost, conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

Frequency

Genomes: not found (cov: 32)

Consequence

MSH3
NM_002439.5 start_lost, conservative_inframe_deletion

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, single submitter U:1

Conservation

PhyloP100: 0.397
Variant links:
Genes affected
MSH3 (HGNC:7326): (mutS homolog 3) The protein encoded by this gene forms a heterodimer with MSH2 to form MutS beta, part of the post-replicative DNA mismatch repair system. MutS beta initiates mismatch repair by binding to a mismatch and then forming a complex with MutL alpha heterodimer. This gene contains a polymorphic 9 bp tandem repeat sequence in the first exon. The repeat is present 6 times in the reference genome sequence and 3-7 repeats have been reported. Defects in this gene are a cause of susceptibility to endometrial cancer. [provided by RefSeq, Mar 2011]
DHFR (HGNC:2861): (dihydrofolate reductase) Dihydrofolate reductase converts dihydrofolate into tetrahydrofolate, a methyl group shuttle required for the de novo synthesis of purines, thymidylic acid, and certain amino acids. While the functional dihydrofolate reductase gene has been mapped to chromosome 5, multiple intronless processed pseudogenes or dihydrofolate reductase-like genes have been identified on separate chromosomes. Dihydrofolate reductase deficiency has been linked to megaloblastic anemia. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2014]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 10 ACMG points.

PVS1
Start lost variant, no new inframe start found.
PM2
Very rare variant in population databases, with high coverage;

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect #exon/exons MANE Protein UniProt
MSH3NM_002439.5 linkc.-18_27delTGCCATCCTTGCCCTGCCATGTCTCGCCGGAAGCCTGCGTCGGGC p.Met1_Gly9del start_lost, conservative_inframe_deletion 1/24 ENST00000265081.7 NP_002430.3 P20585
MSH3NM_002439.5 linkc.-18_27delTGCCATCCTTGCCCTGCCATGTCTCGCCGGAAGCCTGCGTCGGGC 5_prime_UTR_variant 1/24 ENST00000265081.7 NP_002430.3 P20585
DHFRNM_000791.4 linkc.-260_-216delACGCAGGCTTCCGGCGAGACATGGCAGGGCAAGGATGGCAGCCCG 5_prime_UTR_variant 1/6 ENST00000439211.7 NP_000782.1 P00374-1B0YJ76

Ensembl

Gene Transcript HGVSc HGVSp Effect #exon/exons TSL MANE Protein Appris UniProt
MSH3ENST00000265081.7 linkc.-18_27delTGCCATCCTTGCCCTGCCATGTCTCGCCGGAAGCCTGCGTCGGGC p.Met1_Gly9del start_lost, conservative_inframe_deletion 1/241 NM_002439.5 ENSP00000265081.6 P20585
MSH3ENST00000667069.1 linkc.-18_27delTGCCATCCTTGCCCTGCCATGTCTCGCCGGAAGCCTGCGTCGGGC p.Met1_Gly9del start_lost, conservative_inframe_deletion 1/22 ENSP00000499502.1 A0A590UJN8
MSH3ENST00000265081 linkc.-18_27delTGCCATCCTTGCCCTGCCATGTCTCGCCGGAAGCCTGCGTCGGGC 5_prime_UTR_variant 1/241 NM_002439.5 ENSP00000265081.6 P20585
DHFRENST00000439211.7 linkc.-260_-216delACGCAGGCTTCCGGCGAGACATGGCAGGGCAAGGATGGCAGCCCG 5_prime_UTR_variant 1/61 NM_000791.4 ENSP00000396308.2 P00374-1
MSH3ENST00000667069 linkc.-18_27delTGCCATCCTTGCCCTGCCATGTCTCGCCGGAAGCCTGCGTCGGGC 5_prime_UTR_variant 1/22 ENSP00000499502.1 A0A590UJN8
MSH3ENST00000670357.1 linkn.-18_27delTGCCATCCTTGCCCTGCCATGTCTCGCCGGAAGCCTGCGTCGGGC non_coding_transcript_exon_variant 1/25 ENSP00000499791.1 A0A590UKC9
MSH3ENST00000670357.1 linkn.-18_27delTGCCATCCTTGCCCTGCCATGTCTCGCCGGAAGCCTGCGTCGGGC 5_prime_UTR_variant 1/25 ENSP00000499791.1 A0A590UKC9

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

not provided Uncertain:1
Uncertain significance, criteria provided, single submitterclinical testingLabcorp Genetics (formerly Invitae), LabcorpAug 12, 2021This variant is not present in population databases (ExAC no frequency). This sequence change affects the initiator methionine of the MSH3 mRNA. The next in-frame methionine is located at codon 115. This variant has not been reported in the literature in individuals affected with MSH3-related conditions. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr5-79950523; API