5-80654704-CCGGGCTGCCATCCTTGCCCTGCCATGTCTCGCCGGAAGCCTGCGT-C

Position:

• chr5-80654704-CCGGGCTGCCATCCTTGCCCTGCCATGTCTCGCCGGAAGCCTGCGT-C

Variant summary

Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PVS1 PM2

The NM_002439.5(MSH3):​c.-18_27delTGCCATCCTTGCCCTGCCATGTCTCGCCGGAAGCCTGCGTCGGGC​(p.Met1_Gly9del) variant causes a start lost, conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: MSH3 NM_002439.5 start_lost, conservative_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 0.397

Genes affected

MSH3 (HGNC:7326): (mutS homolog 3) The protein encoded by this gene forms a heterodimer with MSH2 to form MutS beta, part of the post-replicative DNA mismatch repair system. MutS beta initiates mismatch repair by binding to a mismatch and then forming a complex with MutL alpha heterodimer. This gene contains a polymorphic 9 bp tandem repeat sequence in the first exon. The repeat is present 6 times in the reference genome sequence and 3-7 repeats have been reported. Defects in this gene are a cause of susceptibility to endometrial cancer. [provided by RefSeq, Mar 2011]

DHFR (HGNC:2861): (dihydrofolate reductase) Dihydrofolate reductase converts dihydrofolate into tetrahydrofolate, a methyl group shuttle required for the de novo synthesis of purines, thymidylic acid, and certain amino acids. While the functional dihydrofolate reductase gene has been mapped to chromosome 5, multiple intronless processed pseudogenes or dihydrofolate reductase-like genes have been identified on separate chromosomes. Dihydrofolate reductase deficiency has been linked to megaloblastic anemia. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2014]

DHFR (HGNC:):

ACMG classification

Verdict is Pathogenic. Variant got 10 ACMG points.

• PVS1: Start lost variant, no new inframe start found.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
MSH3	NM_002439.5	c.-18_27delTGCCATCCTTGCCCTGCCATGTCTCGCCGGAAGCCTGCGTCGGGC	p.Met1_Gly9del	start_lost, conservative_inframe_deletion	1/24	ENST00000265081.7	NP_002430.3
MSH3	NM_002439.5	c.-18_27delTGCCATCCTTGCCCTGCCATGTCTCGCCGGAAGCCTGCGTCGGGC		5_prime_UTR_variant	1/24	ENST00000265081.7	NP_002430.3
DHFR	NM_000791.4	c.-260_-216delACGCAGGCTTCCGGCGAGACATGGCAGGGCAAGGATGGCAGCCCG		5_prime_UTR_variant	1/6	ENST00000439211.7	NP_000782.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
MSH3	ENST00000265081.7	c.-18_27delTGCCATCCTTGCCCTGCCATGTCTCGCCGGAAGCCTGCGTCGGGC	p.Met1_Gly9del	start_lost, conservative_inframe_deletion	1/24	1	NM_002439.5	ENSP00000265081.6
MSH3	ENST00000667069.1	c.-18_27delTGCCATCCTTGCCCTGCCATGTCTCGCCGGAAGCCTGCGTCGGGC	p.Met1_Gly9del	start_lost, conservative_inframe_deletion	1/22			ENSP00000499502.1
MSH3	ENST00000265081	c.-18_27delTGCCATCCTTGCCCTGCCATGTCTCGCCGGAAGCCTGCGTCGGGC		5_prime_UTR_variant	1/24	1	NM_002439.5	ENSP00000265081.6
DHFR	ENST00000439211.7	c.-260_-216delACGCAGGCTTCCGGCGAGACATGGCAGGGCAAGGATGGCAGCCCG		5_prime_UTR_variant	1/6	1	NM_000791.4	ENSP00000396308.2
MSH3	ENST00000667069	c.-18_27delTGCCATCCTTGCCCTGCCATGTCTCGCCGGAAGCCTGCGTCGGGC		5_prime_UTR_variant	1/22			ENSP00000499502.1
MSH3	ENST00000670357.1	n.-18_27delTGCCATCCTTGCCCTGCCATGTCTCGCCGGAAGCCTGCGTCGGGC		non_coding_transcript_exon_variant	1/25			ENSP00000499791.1
MSH3	ENST00000670357.1	n.-18_27delTGCCATCCTTGCCCTGCCATGTCTCGCCGGAAGCCTGCGTCGGGC		5_prime_UTR_variant	1/25			ENSP00000499791.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Aug 12, 2021

This variant is not present in population databases (ExAC no frequency). This sequence change affects the initiator methionine of the MSH3 mRNA. The next in-frame methionine is located at codon 115. This variant has not been reported in the literature in individuals affected with MSH3-related conditions. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr5-79950523;