6-16327684-ATGCTGCTGCTGCTGCTGCTGCTGCTGCTGC-A

Variant names:

• chr6-16327684-ATGCTGCTGCTGCTGCTGCTGCTGCTGCTGC-A
• rs193922926
• NM_001128164.2:c.597_626delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP3

The NM_001128164.2(ATXN1):​c.597_626delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA​(p.Gln199_Gln208del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.000015 (0 hom., cov: 20)
  • Exomes 𝑓: 0.000017 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: ATXN1 NM_001128164.2 disruptive_inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.123
• Publications: 0 publications found

Genes affected

ATXN1 (HGNC:10548): (ataxin 1) The autosomal dominant cerebellar ataxias (ADCA) are a heterogeneous group of neurodegenerative disorders characterized by progressive degeneration of the cerebellum, brain stem and spinal cord. Clinically, ADCA has been divided into three groups: ADCA types I-III. ADCAI is genetically heterogeneous, with five genetic loci, designated spinocerebellar ataxia (SCA) 1, 2, 3, 4 and 6, being assigned to five different chromosomes. ADCAII, which always presents with retinal degeneration (SCA7), and ADCAIII often referred to as the `pure' cerebellar syndrome (SCA5), are most likely homogeneous disorders. Several SCA genes have been cloned and shown to contain CAG repeats in their coding regions. ADCA is caused by the expansion of the CAG repeats, producing an elongated polyglutamine tract in the corresponding protein. The expanded repeats are variable in size and unstable, usually increasing in size when transmitted to successive generations. The function of the ataxins is not known. This locus has been mapped to chromosome 6, and it has been determined that the diseased allele contains 40-83 CAG repeats, compared to 6-39 in the normal allele, and is associated with spinocerebellar ataxia type 1 (SCA1). Alternative splicing results in multiple transcript variants, with one variant encoding multiple distinct proteins, ATXN1 and Alt-ATXN1, due to the use of overlapping alternate reading frames. [provided by RefSeq, Nov 2017]

ATXN1 Gene-Disease associations (from GenCC):

• spinocerebellar ataxia type 1

  Inheritance: AD Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Ambry Genetics, Orphanet, Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Likely_benign. The variant received -1 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_001128164.2

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ATXN1	NM_001128164.2	c.597_626delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln199_Gln208del	disruptive_inframe_deletion	Exon 7 of 8	ENST00000436367.6	NP_001121636.1
ATXN1	NM_000332.4	c.597_626delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln199_Gln208del	disruptive_inframe_deletion	Exon 8 of 9		NP_000323.2
ATXN1	NM_001357857.2	c.*10_*39delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA		3_prime_UTR_variant	Exon 8 of 9		NP_001344786.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ATXN1	ENST00000436367.6	c.597_626delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln199_Gln208del	disruptive_inframe_deletion	Exon 7 of 8	1	NM_001128164.2	ENSP00000416360.1
ATXN1	ENST00000244769.8	c.597_626delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln199_Gln208del	disruptive_inframe_deletion	Exon 8 of 9	1		ENSP00000244769.3
ATXN1	ENST00000642969.1	c.*10_*39delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA		downstream_gene_variant				ENSP00000493530.1

Frequencies

GnomAD3 genomes AF: 0.0000149 AC: 2 AN: 134644 Hom.: 0 Cov.: 20

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.000305

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000155

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000172 AC: 23 AN: 1339454 Hom.: 0 AF XY: 0.0000135 AC XY: 9 AN XY: 665482

African (AFR) AF: 0.00 AC: 0 AN: 26546

American (AMR) AF: 0.00 AC: 0 AN: 35508

Ashkenazi Jewish (ASJ) AF: 0.0000804 AC: 2 AN: 24870

East Asian (EAS) AF: 0.00 AC: 0 AN: 30604

South Asian (SAS) AF: 0.00 AC: 0 AN: 74462

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 40210

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 4600

European-Non Finnish (NFE) AF: 0.0000191 AC: 20 AN: 1047586

Other (OTH) AF: 0.0000182 AC: 1 AN: 55068

GnomAD4 genome AF: 0.0000149 AC: 2 AN: 134644 Hom.: 0 Cov.: 20 AF XY: 0.00 AC XY: 0 AN XY: 65412

African (AFR) AF: 0.00 AC: 0 AN: 32724

American (AMR) AF: 0.00 AC: 0 AN: 13302

Ashkenazi Jewish (ASJ) AF: 0.000305 AC: 1 AN: 3278

East Asian (EAS) AF: 0.00 AC: 0 AN: 4042

South Asian (SAS) AF: 0.00 AC: 0 AN: 3958

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 9816

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 276

European-Non Finnish (NFE) AF: 0.0000155 AC: 1 AN: 64568

Other (OTH) AF: 0.00 AC: 0 AN: 1816

Alfa AF: 0.00 Hom.: 48

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.12
Mutation Taster		=185/15	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs193922926; hg19: chr6-16327915;