6-16327684-ATGCTGCTGCTGCTGCTGCTGCTGCTGCTGC-ATGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC

Variant names:

• chr6-16327684-A-ATGCTGCTGCTGCTGCTGCTGC
• rs193922926
• NM_001128164.2:c.606_626dupGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Likely benign. The variant received -5 ACMG points: 0P and 5B. BP3 BS2

The NM_001128164.2(ATXN1):​c.606_626dupGCAGCAGCAGCAGCAGCAGCA​(p.Gln202_Gln208dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.00044 (0 hom., cov: 20)
  • Exomes 𝑓: 0.00021 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: ATXN1 NM_001128164.2 disruptive_inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.106
• Publications: 0 publications found

Genes affected

ATXN1 (HGNC:10548): (ataxin 1) The autosomal dominant cerebellar ataxias (ADCA) are a heterogeneous group of neurodegenerative disorders characterized by progressive degeneration of the cerebellum, brain stem and spinal cord. Clinically, ADCA has been divided into three groups: ADCA types I-III. ADCAI is genetically heterogeneous, with five genetic loci, designated spinocerebellar ataxia (SCA) 1, 2, 3, 4 and 6, being assigned to five different chromosomes. ADCAII, which always presents with retinal degeneration (SCA7), and ADCAIII often referred to as the `pure' cerebellar syndrome (SCA5), are most likely homogeneous disorders. Several SCA genes have been cloned and shown to contain CAG repeats in their coding regions. ADCA is caused by the expansion of the CAG repeats, producing an elongated polyglutamine tract in the corresponding protein. The expanded repeats are variable in size and unstable, usually increasing in size when transmitted to successive generations. The function of the ataxins is not known. This locus has been mapped to chromosome 6, and it has been determined that the diseased allele contains 40-83 CAG repeats, compared to 6-39 in the normal allele, and is associated with spinocerebellar ataxia type 1 (SCA1). Alternative splicing results in multiple transcript variants, with one variant encoding multiple distinct proteins, ATXN1 and Alt-ATXN1, due to the use of overlapping alternate reading frames. [provided by RefSeq, Nov 2017]

ATXN1 Gene-Disease associations (from GenCC):

• spinocerebellar ataxia type 1

  Inheritance: AD Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Ambry Genetics, Orphanet, Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Likely_benign. The variant received -5 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_001128164.2
• BS2: High AC in GnomAd4 at 59 AD gene.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001128164.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ATXN1	NM_001128164.2	MANE Select	c.606_626dupGCAGCAGCAGCAGCAGCAGCA	p.Gln202_Gln208dup	disruptive_inframe_insertion	Exon 7 of 8	NP_001121636.1
	ATXN1	NM_000332.4		c.606_626dupGCAGCAGCAGCAGCAGCAGCA	p.Gln202_Gln208dup	disruptive_inframe_insertion	Exon 8 of 9	NP_000323.2
	ATXN1	NM_001357857.2		c.*19_*39dupGCAGCAGCAGCAGCAGCAGCA		3_prime_UTR	Exon 8 of 9	NP_001344786.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ATXN1	ENST00000436367.6	TSL:1 MANE Select	c.606_626dupGCAGCAGCAGCAGCAGCAGCA	p.Gln202_Gln208dup	disruptive_inframe_insertion	Exon 7 of 8	ENSP00000416360.1
	ATXN1	ENST00000244769.8	TSL:1	c.606_626dupGCAGCAGCAGCAGCAGCAGCA	p.Gln202_Gln208dup	disruptive_inframe_insertion	Exon 8 of 9	ENSP00000244769.3
	ATXN1	ENST00000642969.1		c.*19_*39dupGCAGCAGCAGCAGCAGCAGCA		downstream_gene	N/A	ENSP00000493530.1

Frequencies

GnomAD3 genomes AF: 0.000431 AC: 58 AN: 134642 Hom.: 0 Cov.: 20

Gnomad AFR AF: 0.000611

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000150

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00126

Gnomad FIN AF: 0.000102

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000465

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000208 AC: 278 AN: 1339082 Hom.: 0 Cov.: 32 AF XY: 0.000236 AC XY: 157 AN XY: 665288

African (AFR) AF: 0.000490 AC: 13 AN: 26532

American (AMR) AF: 0.000169 AC: 6 AN: 35504

Ashkenazi Jewish (ASJ) AF: 0.000161 AC: 4 AN: 24868

East Asian (EAS) AF: 0.0000654 AC: 2 AN: 30602

South Asian (SAS) AF: 0.000390 AC: 29 AN: 74444

European-Finnish (FIN) AF: 0.0000746 AC: 3 AN: 40208

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 4600

European-Non Finnish (NFE) AF: 0.000203 AC: 213 AN: 1047266

Other (OTH) AF: 0.000145 AC: 8 AN: 55058

GnomAD4 genome AF: 0.000438 AC: 59 AN: 134740 Hom.: 0 Cov.: 20 AF XY: 0.000412 AC XY: 27 AN XY: 65506

African (AFR) AF: 0.000640 AC: 21 AN: 32836

American (AMR) AF: 0.000150 AC: 2 AN: 13314

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3278

East Asian (EAS) AF: 0.00 AC: 0 AN: 4028

South Asian (SAS) AF: 0.00126 AC: 5 AN: 3956

European-Finnish (FIN) AF: 0.000102 AC: 1 AN: 9816

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 258

European-Non Finnish (NFE) AF: 0.000465 AC: 30 AN: 64556

Other (OTH) AF: 0.00 AC: 0 AN: 1834

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.11
Mutation Taster		=91/9	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs193922926; hg19: chr6-16327915;