6-16327684-ATGCTGCTGCTGCTGCTGCTGCTGCTGCTGC-ATGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC

Position:

• chr6-16327684-ATGCTGCTGCTGCTGCTGCTGCTGCTGCTGC-ATGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC

Variant summary

Our verdict is Likely benign. Variant got -4 ACMG points: 0P and 4B. BS2

The NM_001128164.2(ATXN1):​c.600_626dupGCAGCAGCAGCAGCAGCAGCAGCAGCA​(p.Gln200_Gln208dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.00018 (1 hom., cov: 20)
  • Exomes 𝑓: 0.00017 (2 hom.)
  • Failed GnomAD Quality Control
• Consequence: ATXN1 NM_001128164.2 disruptive_inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.106

Genes affected

ATXN1 (HGNC:10548): (ataxin 1) The autosomal dominant cerebellar ataxias (ADCA) are a heterogeneous group of neurodegenerative disorders characterized by progressive degeneration of the cerebellum, brain stem and spinal cord. Clinically, ADCA has been divided into three groups: ADCA types I-III. ADCAI is genetically heterogeneous, with five genetic loci, designated spinocerebellar ataxia (SCA) 1, 2, 3, 4 and 6, being assigned to five different chromosomes. ADCAII, which always presents with retinal degeneration (SCA7), and ADCAIII often referred to as the `pure' cerebellar syndrome (SCA5), are most likely homogeneous disorders. Several SCA genes have been cloned and shown to contain CAG repeats in their coding regions. ADCA is caused by the expansion of the CAG repeats, producing an elongated polyglutamine tract in the corresponding protein. The expanded repeats are variable in size and unstable, usually increasing in size when transmitted to successive generations. The function of the ataxins is not known. This locus has been mapped to chromosome 6, and it has been determined that the diseased allele contains 40-83 CAG repeats, compared to 6-39 in the normal allele, and is associated with spinocerebellar ataxia type 1 (SCA1). Alternative splicing results in multiple transcript variants, with one variant encoding multiple distinct proteins, ATXN1 and Alt-ATXN1, due to the use of overlapping alternate reading frames. [provided by RefSeq, Nov 2017]

ACMG classification

Verdict is Likely_benign. Variant got -4 ACMG points.

• BS2: High AC in GnomAd4 at 24 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
ATXN1	NM_001128164.2	c.600_626dupGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln200_Gln208dup	disruptive_inframe_insertion	7/8	ENST00000436367.6	NP_001121636.1
ATXN1	NM_000332.4	c.600_626dupGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln200_Gln208dup	disruptive_inframe_insertion	8/9		NP_000323.2
ATXN1	NM_001357857.2	c.*13_*39dupGCAGCAGCAGCAGCAGCAGCAGCAGCA		3_prime_UTR_variant	8/9		NP_001344786.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
ATXN1	ENST00000436367.6	c.600_626dupGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln200_Gln208dup	disruptive_inframe_insertion	7/8	1	NM_001128164.2	ENSP00000416360.1
ATXN1	ENST00000244769.8	c.600_626dupGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln200_Gln208dup	disruptive_inframe_insertion	8/9	1		ENSP00000244769.3
ATXN1	ENST00000642969.1	c.*13_*39dupGCAGCAGCAGCAGCAGCAGCAGCAGCA		downstream_gene_variant				ENSP00000493530.1

Frequencies

GnomAD3 genomes AF: 0.000178 AC: 24 AN: 134642 Hom.: 1 Cov.: 20

Gnomad AFR AF: 0.0000611

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0000752

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00177

Gnomad FIN AF: 0.000102

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000201

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000166 AC: 222 AN: 1339224 Hom.: 2 Cov.: 32 AF XY: 0.000212 AC XY: 141 AN XY: 665362

Gnomad4 AFR exome AF: 0.0000377

Gnomad4 AMR exome AF: 0.0000563

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00130

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.000108

Gnomad4 OTH exome AF: 0.000145

GnomAD4 genome AF: 0.000178 AC: 24 AN: 134740 Hom.: 1 Cov.: 20 AF XY: 0.000214 AC XY: 14 AN XY: 65508

Gnomad4 AFR AF: 0.0000609

Gnomad4 AMR AF: 0.0000751

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00177

Gnomad4 FIN AF: 0.000102

Gnomad4 NFE AF: 0.000201

Gnomad4 OTH AF: 0.00

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs193922926; hg19: chr6-16327915;