6-16327684-ATGCTGCTGCTGCTGCTGCTGCTGCTGCTGC-ATGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC

Variant names:

• chr6-16327684-A-ATGCTGCTGCTGCTGCTGCTGCTGCTGC
• rs193922926
• NM_001128164.2:c.600_626dupGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Likely benign. The variant received -5 ACMG points: 0P and 5B. BP3 BS2

The NM_001128164.2(ATXN1):​c.600_626dupGCAGCAGCAGCAGCAGCAGCAGCAGCA​(p.Gln200_Gln208dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.00018 (1 hom., cov: 20)
  • Exomes 𝑓: 0.00017 (2 hom.)
  • Failed GnomAD Quality Control
• Consequence: ATXN1 NM_001128164.2 disruptive_inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.106
• Publications: 0 publications found

Genes affected

ATXN1 (HGNC:10548): (ataxin 1) The autosomal dominant cerebellar ataxias (ADCA) are a heterogeneous group of neurodegenerative disorders characterized by progressive degeneration of the cerebellum, brain stem and spinal cord. Clinically, ADCA has been divided into three groups: ADCA types I-III. ADCAI is genetically heterogeneous, with five genetic loci, designated spinocerebellar ataxia (SCA) 1, 2, 3, 4 and 6, being assigned to five different chromosomes. ADCAII, which always presents with retinal degeneration (SCA7), and ADCAIII often referred to as the `pure' cerebellar syndrome (SCA5), are most likely homogeneous disorders. Several SCA genes have been cloned and shown to contain CAG repeats in their coding regions. ADCA is caused by the expansion of the CAG repeats, producing an elongated polyglutamine tract in the corresponding protein. The expanded repeats are variable in size and unstable, usually increasing in size when transmitted to successive generations. The function of the ataxins is not known. This locus has been mapped to chromosome 6, and it has been determined that the diseased allele contains 40-83 CAG repeats, compared to 6-39 in the normal allele, and is associated with spinocerebellar ataxia type 1 (SCA1). Alternative splicing results in multiple transcript variants, with one variant encoding multiple distinct proteins, ATXN1 and Alt-ATXN1, due to the use of overlapping alternate reading frames. [provided by RefSeq, Nov 2017]

ATXN1 Gene-Disease associations (from GenCC):

• spinocerebellar ataxia type 1

  Inheritance: AD Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), Orphanet

ACMG classification

Our verdict: Likely_benign. The variant received -5 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_001128164.2
• BS2: High AC in GnomAd4 at 24 AD gene.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001128164.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ATXN1	NM_001128164.2	MANE Select	c.600_626dupGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln200_Gln208dup	disruptive_inframe_insertion	Exon 7 of 8	NP_001121636.1	P54253-1
	ATXN1	NM_000332.4		c.600_626dupGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln200_Gln208dup	disruptive_inframe_insertion	Exon 8 of 9	NP_000323.2	P54253-1
	ATXN1	NM_001357857.2		c.*13_*39dupGCAGCAGCAGCAGCAGCAGCAGCAGCA		3_prime_UTR	Exon 8 of 9	NP_001344786.1	A0A2R8YCF3

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ATXN1	ENST00000436367.6	TSL:1 MANE Select	c.600_626dupGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln200_Gln208dup	disruptive_inframe_insertion	Exon 7 of 8	ENSP00000416360.1	P54253-1
	ATXN1	ENST00000244769.8	TSL:1	c.600_626dupGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln200_Gln208dup	disruptive_inframe_insertion	Exon 8 of 9	ENSP00000244769.3	P54253-1
	ATXN1	ENST00000642969.1		c.*13_*39dupGCAGCAGCAGCAGCAGCAGCAGCAGCA		downstream_gene	N/A	ENSP00000493530.1	A0A2R8YCF3

Frequencies

GnomAD3 genomes AF: 0.000178 AC: 24 AN: 134642 Hom.: 1 Cov.: 20

Gnomad AFR AF: 0.0000611

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0000752

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00177

Gnomad FIN AF: 0.000102

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000201

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000166 AC: 222 AN: 1339224 Hom.: 2 Cov.: 32 AF XY: 0.000212 AC XY: 141 AN XY: 665362

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.0000377 AC: 1 AN: 26544

American (AMR) AF: 0.0000563 AC: 2 AN: 35502

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 24870

East Asian (EAS) AF: 0.00 AC: 0 AN: 30604

South Asian (SAS) AF: 0.00130 AC: 97 AN: 74396

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 40210

Middle Eastern (MID) AF: 0.000217 AC: 1 AN: 4598

European-Non Finnish (NFE) AF: 0.000108 AC: 113 AN: 1047444

Other (OTH) AF: 0.000145 AC: 8 AN: 55056

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.000178 AC: 24 AN: 134740 Hom.: 1 Cov.: 20 AF XY: 0.000214 AC XY: 14 AN XY: 65508

African (AFR) AF: 0.0000609 AC: 2 AN: 32836

American (AMR) AF: 0.0000751 AC: 1 AN: 13314

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3278

East Asian (EAS) AF: 0.00 AC: 0 AN: 4028

South Asian (SAS) AF: 0.00177 AC: 7 AN: 3954

European-Finnish (FIN) AF: 0.000102 AC: 1 AN: 9816

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 258

European-Non Finnish (NFE) AF: 0.000201 AC: 13 AN: 64558

Other (OTH) AF: 0.00 AC: 0 AN: 1834

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.11
Mutation Taster		=91/9	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs193922926; hg19: chr6-16327915;