6-170561958-ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG-ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG

Variant names:

• chr6-170561958-A-ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG
• NM_003194.5:c.243_281dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Uncertain significance. Variant got 1 ACMG points: 2P and 1B. PM2 BP3

The NM_003194.5(TBP):​c.243_281dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA​(p.Gln82_Gln94dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000697 in 143,478 control chromosomes in the GnomAD database, with no homozygous occurrence. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: 𝑓 0.0000070 (0 hom., cov: 24)
• Consequence: TBP NM_003194.5 disruptive_inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.290

Genes affected

TBP (HGNC:11588): (TATA-box binding protein) Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes TBP, the TATA-binding protein. A distinctive feature of TBP is a long string of glutamines in the N-terminus. This region of the protein modulates the DNA binding activity of the C terminus, and modulation of DNA binding affects the rate of transcription complex formation and initiation of transcription. The number of CAG repeats encoding the polyglutamine tract is usually 25-42, and expansion of the number of repeats to 45-66 increases the length of the polyglutamine string and is associated with spinocerebellar ataxia 17, a neurodegenerative disorder classified as a polyglutamine disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2016]

ACMG classification

Verdict is Uncertain_significance. Variant got 1 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• BP3: Nonframeshift variant in repetitive region in NM_003194.5

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
TBP	NM_003194.5	c.243_281dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln82_Gln94dup	disruptive_inframe_insertion	Exon 3 of 8	ENST00000392092.7	NP_003185.1
TBP	NM_001172085.2	c.183_221dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln62_Gln74dup	disruptive_inframe_insertion	Exon 2 of 7		NP_001165556.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
TBP	ENST00000392092.7	c.243_281dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln82_Gln94dup	disruptive_inframe_insertion	Exon 3 of 8	1	NM_003194.5	ENSP00000375942.2

Frequencies

GnomAD3 genomes AF: 0.00000697 AC: 1 AN: 143372 Hom.: 0 Cov.: 24

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.000203

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD4 exome Cov.: 0

GnomAD4 genome AF: 0.00000697 AC: 1 AN: 143478 Hom.: 0 Cov.: 24 AF XY: 0.00 AC XY: 0 AN XY: 70064

Gnomad4 AFR AF: 0.00

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.000203

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.00

Gnomad4 OTH AF: 0.00

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr6-170871046;