6-5261233-GAGGCCGCGTTGCCCGGGTTACCGA-G

Position:

• chr6-5261233-GAGGCCGCGTTGCCCGGGTTACCGA-G

Variant summary

Our verdict is Benign. Variant got -10 ACMG points: 0P and 10B. BP6_Moderate BA1

The NM_001318872.2(FARS2):​c.-139_-116delGTTGCCCGGGTTACCGAAGGCCGC variant causes a 5 prime UTR change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0302 in 152,988 control chromosomes in the GnomAD database, including 130 homozygotes. Variant has been reported in ClinVar as Benign (★).

• Frequency:
  • Genomes: 𝑓 0.030 (128 hom., cov: 34)
  • Exomes 𝑓: 0.040 (2 hom.)
• Consequence: FARS2 NM_001318872.2 5_prime_UTR
• Clinical Significance: Benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 3.28

Genes affected

FARS2 (HGNC:21062): (phenylalanyl-tRNA synthetase 2, mitochondrial) This gene encodes a protein that transfers phenylalanine to its cognate tRNA. This protein localizes to the mitochondrion and plays a role in mitochondrial protein translation. Mutations in this gene can cause combined oxidative phosphorylation deficiency 14 (Alpers encephalopathy). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]

FARS2 (HGNC:):

ACMG classification

Verdict is Benign. Variant got -10 ACMG points.

• BP6: Variant 6-5261233-GAGGCCGCGTTGCCCGGGTTACCGA-G is Benign according to our data. Variant chr6-5261233-GAGGCCGCGTTGCCCGGGTTACCGA-G is described in ClinVar as [Benign]. Clinvar id is 1293909.Status of the report is criteria_provided_single_submitter, 1 stars.
• BA1: GnomAd4 highest subpopulation (SAS) allele frequency at 95% confidence interval = 0.103 is higher than 0.05.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
FARS2	NM_001318872.2	c.-139_-116delGTTGCCCGGGTTACCGAAGGCCGC		5_prime_UTR_variant	1/7		NP_001305801.1
FARS2	NM_001374878.1	c.-172_-149delGTTGCCCGGGTTACCGAAGGCCGC		5_prime_UTR_variant	1/7		NP_001361807.1
FARS2	XM_047418087.1	c.-139_-116delGTTGCCCGGGTTACCGAAGGCCGC		5_prime_UTR_variant	1/5		XP_047274043.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
FARS2	ENST00000324331	c.-139_-116delGTTGCCCGGGTTACCGAAGGCCGC		5_prime_UTR_variant	1/7	1		ENSP00000316335.5

Frequencies

GnomAD3 genomes AF: 0.0302 AC: 4584 AN: 151976 Hom.: 129 Cov.: 34

Gnomad AFR AF: 0.00631

Gnomad AMI AF: 0.0143

Gnomad AMR AF: 0.0660

Gnomad ASJ AF: 0.0693

Gnomad EAS AF: 0.0514

Gnomad SAS AF: 0.111

Gnomad FIN AF: 0.0555

Gnomad MID AF: 0.0255

Gnomad NFE AF: 0.0233

Gnomad OTH AF: 0.0384

GnomAD4 exome AF: 0.0404 AC: 36 AN: 892 Hom.: 2 AF XY: 0.0498 AC XY: 28 AN XY: 562

Gnomad4 AFR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.125

Gnomad4 SAS exome AF: 0.115

Gnomad4 FIN exome AF: 0.125

Gnomad4 NFE exome AF: 0.0163

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome AF: 0.0302 AC: 4590 AN: 152096 Hom.: 128 Cov.: 34 AF XY: 0.0339 AC XY: 2521 AN XY: 74354

Gnomad4 AFR AF: 0.00629

Gnomad4 AMR AF: 0.0662

Gnomad4 ASJ AF: 0.0693

Gnomad4 EAS AF: 0.0518

Gnomad4 SAS AF: 0.111

Gnomad4 FIN AF: 0.0555

Gnomad4 NFE AF: 0.0233

Gnomad4 OTH AF: 0.0398

Alfa AF: 0.0229 Hom.: 6

Bravo AF: 0.0286

Asia WGS AF: 0.104 AC: 359 AN: 3478

ClinVar

Significance: Benign

Submissions summary: Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Benign:1

Benign, criteria provided, single submitter

clinical testing

GeneDx

Jul 08, 2018

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs140478583; hg19: chr6-5261466;