6-81752010-ACCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCG-ACCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCG
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4
The NM_017633.3(TENT5A):c.131_132insCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGG(p.Gly44_Gly45insGlyAspPheGlyGlyGlyAspPheGlyGlyGlyAspPheGlyGlyGlyAspPheGlyGlyGlyAspPheGlyGly) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. G44G) has been classified as Benign.
Frequency
Consequence
NM_017633.3 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- osteogenesis imperfecta, type 18Inheritance: AR Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
- osteogenesis imperfectaInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_017633.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TENT5A | MANE Select | c.131_132insCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGG | p.Gly44_Gly45insGlyAspPheGlyGlyGlyAspPheGlyGlyGlyAspPheGlyGlyGlyAspPheGlyGlyGlyAspPheGlyGly | disruptive_inframe_insertion | Exon 2 of 3 | NP_060103.2 | Q96IP4-1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TENT5A | TSL:1 MANE Select | c.131_132insCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGG | p.Gly44_Gly45insGlyAspPheGlyGlyGlyAspPheGlyGlyGlyAspPheGlyGlyGlyAspPheGlyGlyGlyAspPheGlyGly | disruptive_inframe_insertion | Exon 2 of 3 | ENSP00000318298.6 | Q96IP4-1 | ||
| TENT5A | TSL:1 | c.374_375insCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGG | p.Gly125_Gly126insGlyAspPheGlyGlyGlyAspPheGlyGlyGlyAspPheGlyGlyGlyAspPheGlyGlyGlyAspPheGlyGly | disruptive_inframe_insertion | Exon 2 of 3 | ENSP00000358771.3 | Q5TF85 | ||
| TENT5A | TSL:1 | c.188_189insCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGGCGGCGACTTCGGCGG | p.Gly63_Gly64insGlyAspPheGlyGlyGlyAspPheGlyGlyGlyAspPheGlyGlyGlyAspPheGlyGlyGlyAspPheGlyGly | disruptive_inframe_insertion | Exon 2 of 3 | ENSP00000358769.3 | Q96IP4-2 |
Frequencies
GnomAD3 genomes AF: 0.00000716 AC: 1AN: 139636Hom.: 0 Cov.: 0 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000116 AC: 14AN: 1201954Hom.: 0 Cov.: 34 AF XY: 0.0000116 AC XY: 7AN XY: 603570 show subpopulations
GnomAD4 genome AF: 0.00000716 AC: 1AN: 139636Hom.: 0 Cov.: 0 AF XY: 0.00 AC XY: 0AN XY: 67628 show subpopulations
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at