7-100720818-CCACCGCGCCCGCTCTGCTCCGA-C

Variant names:

• chr7-100720818-CCACCGCGCCCGCTCTGCTCCGA-C
• rs542975821
• NM_000799.4:c.-152_-131delGCTCTGCTCCGACACCGCGCCC

Variant summary

Our verdict is Likely benign. Variant got -5 ACMG points: 0P and 5B. BS1_Supporting BS2

The NM_000799.4(EPO):​c.-152_-131delGCTCTGCTCCGACACCGCGCCC variant causes a 5 prime UTR change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00331 in 822,298 control chromosomes in the GnomAD database, including 46 homozygotes. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: 𝑓 0.012 (31 hom., cov: 31)
  • Exomes 𝑓: 0.0014 (15 hom.)
• Consequence: EPO NM_000799.4 5_prime_UTR
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1 B:1
• Conservation: PhyloP100: 1.40

Genes affected

EPO (HGNC:3415): (erythropoietin) This gene encodes a secreted, glycosylated cytokine composed of four alpha helical bundles. The encoded protein is mainly synthesized in the kidney, secreted into the blood plasma, and binds to the erythropoietin receptor to promote red blood cell production, or erythropoiesis, in the bone marrow. Expression of this gene is upregulated under hypoxic conditions, in turn leading to increased erythropoiesis and enhanced oxygen-carrying capacity of the blood. Expression of this gene has also been observed in brain and in the eye, and elevated expression levels have been observed in diabetic retinopathy and ocular hypertension. Recombinant forms of the encoded protein exhibit neuroprotective activity against a variety of potential brain injuries, as well as antiapoptotic functions in several tissue types, and have been used in the treatment of anemia and to enhance the efficacy of cancer therapies. [provided by RefSeq, Aug 2017]

ACMG classification

Verdict is Likely_benign. Variant got -5 ACMG points.

• BS1: Variant frequency is greater than expected in population afr. gnomad4 allele frequency = 0.0118 (1801/152226) while in subpopulation AFR AF= 0.04 (1662/41550). AF 95% confidence interval is 0.0384. There are 31 homozygotes in gnomad4. There are 843 alleles in male gnomad4 subpopulation. Median coverage is 31. This position pass quality control queck. Existence of Clinvar submissions makes me limit the strength of this signal to Supporting
• BS2: High Homozygotes in GnomAd4 at 31 AD,AR gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
EPO	NM_000799.4	c.-152_-131delGCTCTGCTCCGACACCGCGCCC		5_prime_UTR_variant	Exon 1 of 5	ENST00000252723.3	NP_000790.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
EPO	ENST00000252723	c.-152_-131delGCTCTGCTCCGACACCGCGCCC		5_prime_UTR_variant	Exon 1 of 5	1	NM_000799.4	ENSP00000252723.2

Frequencies

GnomAD3 genomes AF: 0.0118 AC: 1794 AN: 152118 Hom.: 31 Cov.: 31

Gnomad AFR AF: 0.0399

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00681

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.000207

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00318

Gnomad NFE AF: 0.000162

Gnomad OTH AF: 0.0105

GnomAD4 exome AF: 0.00137 AC: 917 AN: 670072 Hom.: 15 AF XY: 0.00123 AC XY: 408 AN XY: 331080

Gnomad4 AFR exome AF: 0.0489

Gnomad4 AMR exome AF: 0.00518

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.0000781

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.000122

Gnomad4 OTH exome AF: 0.00323

GnomAD4 genome AF: 0.0118 AC: 1801 AN: 152226 Hom.: 31 Cov.: 31 AF XY: 0.0113 AC XY: 843 AN XY: 74412

Gnomad4 AFR AF: 0.0400

Gnomad4 AMR AF: 0.00680

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.000207

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.000162

Gnomad4 OTH AF: 0.0104

Alfa AF: 0.00989 Hom.: 2

Bravo AF: 0.0133

Asia WGS AF: 0.000870 AC: 3 AN: 3462

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1 Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Uncertain:1

Apr 22, 2024

Mayo Clinic Laboratories, Mayo Clinic

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

BS1, BS2, BP4, BP7 -

EPO-related disorder Benign:1

Jul 01, 2019

PreventionGenetics, part of Exact Sciences

Significance: Likely benign

Review Status: no assertion criteria provided

Collection Method: clinical testing

This variant is classified as likely benign based on ACMG/AMP sequence variant interpretation guidelines (Richards et al. 2015 PMID: 25741868, with internal and published modifications). -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs542975821; hg19: chr7-100318441;