7-126532764-GATATATATATATATATATATATATATATATATATATATATAT-GATATATATATATATATATATATATATATATATATATATATATATATATATATATAT

Variant names:

• chr7-126532764-G-GATATATATATATAT
• rs521
• NM_000845.3:c.2430+174_2430+187dupATATATATATATAT

Variant summary

Our verdict is Likely benign. The variant received -4 ACMG points: 0P and 4B. BS2

The NM_000845.3(GRM8):​c.2430+174_2430+187dupATATATATATATAT variant causes a intron change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: 𝑓 0.00023 (2 hom., cov: 0)
• Consequence: GRM8 NM_000845.3 intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: -0.339
• Publications: 3 publications found

Genes affected

GRM8 (HGNC:4600): (glutamate metabotropic receptor 8) L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]

ENSG00000287568 (HGNC:):

ACMG classification

Our verdict: Likely_benign. The variant received -4 ACMG points.

• BS2: High Homozygotes in GnomAd4 at 2 gene

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000845.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	GRM8	NM_000845.3	MANE Select	c.2430+174_2430+187dupATATATATATATAT		intron	N/A	NP_000836.2	O00222-1
	GRM8	NM_001371086.1		c.2430+174_2430+187dupATATATATATATAT		intron	N/A	NP_001358015.1	A0A9L9PYG5
	GRM8	NM_001127323.1		c.2430+174_2430+187dupATATATATATATAT		intron	N/A	NP_001120795.1	O00222-2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	GRM8	ENST00000339582.7	TSL:5 MANE Select	c.2430+187_2430+188insATATATATATATAT		intron	N/A	ENSP00000344173.2	O00222-1
	GRM8	ENST00000358373.8	TSL:1	c.2430+187_2430+188insATATATATATATAT		intron	N/A	ENSP00000351142.3	O00222-2
	GRM8	ENST00000341617.7	TSL:1	n.*995+187_*995+188insATATATATATATAT		intron	N/A	ENSP00000345747.3	O00222-3

Frequencies

GnomAD3 genomes AF: 0.000225 AC: 25 AN: 110962 Hom.: 2 Cov.: 0

Gnomad AFR AF: 0.0000331

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000313

Gnomad ASJ AF: 0.00142

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000313

Gnomad OTH AF: 0.00

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome AF: 0.000225 AC: 25 AN: 110988 Hom.: 2 Cov.: 0 AF XY: 0.000229 AC XY: 12 AN XY: 52308

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.0000330 AC: 1 AN: 30264

American (AMR) AF: 0.000312 AC: 3 AN: 9602

Ashkenazi Jewish (ASJ) AF: 0.00142 AC: 4 AN: 2822

East Asian (EAS) AF: 0.00 AC: 0 AN: 3784

South Asian (SAS) AF: 0.00 AC: 0 AN: 3178

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 4612

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 226

European-Non Finnish (NFE) AF: 0.000313 AC: 17 AN: 54264

Other (OTH) AF: 0.00 AC: 0 AN: 1546

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5. (p-value = 0.000000716955), which strongly suggests a high chance of mosaicism in these individuals.

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		-0.34

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs521; hg19: chr7-126172818;