7-126532764-GATATATATATATATATATATATATATATATATATATATATAT-GATATATATATATATATATATATATATATATATATATATATATATATATATATATATAT
Variant summary
Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.
The NM_000845.3(GRM8):c.2430+172_2430+187dupATATATATATATATAT variant causes a intron change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NM_000845.3 intron
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 0 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000845.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| GRM8 | NM_000845.3 | MANE Select | c.2430+172_2430+187dupATATATATATATATAT | intron | N/A | NP_000836.2 | O00222-1 | ||
| GRM8 | NM_001371086.1 | c.2430+172_2430+187dupATATATATATATATAT | intron | N/A | NP_001358015.1 | A0A9L9PYG5 | |||
| GRM8 | NM_001127323.1 | c.2430+172_2430+187dupATATATATATATATAT | intron | N/A | NP_001120795.1 | O00222-2 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| GRM8 | ENST00000339582.7 | TSL:5 MANE Select | c.2430+187_2430+188insATATATATATATATAT | intron | N/A | ENSP00000344173.2 | O00222-1 | ||
| GRM8 | ENST00000358373.8 | TSL:1 | c.2430+187_2430+188insATATATATATATATAT | intron | N/A | ENSP00000351142.3 | O00222-2 | ||
| GRM8 | ENST00000341617.7 | TSL:1 | n.*995+187_*995+188insATATATATATATATAT | intron | N/A | ENSP00000345747.3 | O00222-3 |
Frequencies
GnomAD3 genomes AF: 0.0000270 AC: 3AN: 110978Hom.: 0 Cov.: 0 show subpopulations
GnomAD4 genome AF: 0.0000270 AC: 3AN: 111004Hom.: 0 Cov.: 0 AF XY: 0.0000191 AC XY: 1AN XY: 52312 show subpopulations
Age Distribution
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at