7-127652379-G-GTCCTCCGCGCAGAGCGGCGGC

Variant names:

• chr7-127652379-G-GTCCTCCGCGCAGAGCGGCGGC
• rs552710042
• NM_014390.4:c.14_34dupCGCAGAGCGGCGGCTCCTCCG

Variant summary

Our verdict is Benign. The variant received -8 ACMG points: 2P and 10B. PM4 BP6_Moderate BS1 BS2

The NM_014390.4(SND1):​c.14_34dupCGCAGAGCGGCGGCTCCTCCG​(p.Ala5_Ser11dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0103 in 1,596,444 control chromosomes in the GnomAD database, including 162 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Benign (★).

• Frequency:
  • Genomes: 𝑓 0.0078 (19 hom., cov: 33)
  • Exomes 𝑓: 0.011 (143 hom.)
• Consequence: SND1 NM_014390.4 disruptive_inframe_insertion
• Clinical Significance: Benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 1.70
• Publications: 2 publications found

Genes affected

SND1 (HGNC:30646): (staphylococcal nuclease and tudor domain containing 1) This gene encodes a transcriptional co-activator that interacts with the acidic domain of Epstein-Barr virus nuclear antigen 2 (EBNA 2), a transcriptional activator that is required for B-lymphocyte transformation. Other transcription factors that interact with this protein are signal transducers and activators of transcription, STATs. This protein is also thought to be essential for normal cell growth. A similar protein in mammals and other organisms is a component of the RNA-induced silencing complex (RISC). [provided by RefSeq, Jul 2016]

ACMG classification

Our verdict: Benign. The variant received -8 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_014390.4.
• BP6: Variant 7-127652379-G-GTCCTCCGCGCAGAGCGGCGGC is Benign according to our data. Variant chr7-127652379-G-GTCCTCCGCGCAGAGCGGCGGC is described in ClinVar as [Benign]. Clinvar id is 718333.Status of the report is criteria_provided_single_submitter, 1 stars.
• BS1: Variant frequency is greater than expected in population sas. GnomAd4 allele frequency = 0.00775 (1181/152306) while in subpopulation SAS AF = 0.0423 (204/4824). AF 95% confidence interval is 0.0375. There are 19 homozygotes in GnomAd4. There are 591 alleles in the male GnomAd4 subpopulation. Median coverage is 33. This position passed quality control check.
• BS2: High AC in GnomAd4 at 1181 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
SND1	NM_014390.4	c.14_34dupCGCAGAGCGGCGGCTCCTCCG	p.Ala5_Ser11dup	disruptive_inframe_insertion	Exon 1 of 24	ENST00000354725.8	NP_055205.2
SND1	XM_017011987.3	c.14_34dupCGCAGAGCGGCGGCTCCTCCG	p.Ala5_Ser11dup	disruptive_inframe_insertion	Exon 1 of 17		XP_016867476.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
SND1	ENST00000354725.8	c.14_34dupCGCAGAGCGGCGGCTCCTCCG	p.Ala5_Ser11dup	disruptive_inframe_insertion	Exon 1 of 24	1	NM_014390.4	ENSP00000346762.3
SND1	ENST00000463020.1	n.194_214dupCGCAGAGCGGCGGCTCCTCCG		non_coding_transcript_exon_variant	Exon 1 of 2	2

Frequencies

GnomAD3 genomes AF: 0.00776 AC: 1181 AN: 152188 Hom.: 19 Cov.: 33

Gnomad AFR AF: 0.00169

Gnomad AMI AF: 0.0208

Gnomad AMR AF: 0.00419

Gnomad ASJ AF: 0.00519

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.0420

Gnomad FIN AF: 0.0110

Gnomad MID AF: 0.0158

Gnomad NFE AF: 0.00980

Gnomad OTH AF: 0.00860

GnomAD2 exomes AF: 0.00789 AC: 1706 AN: 216140 AF XY: 0.00900

Gnomad AFR exome AF: 0.000608

Gnomad AMR exome AF: 0.00200

Gnomad ASJ exome AF: 0.00365

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00913

Gnomad NFE exome AF: 0.00570

Gnomad OTH exome AF: 0.00860

GnomAD4 exome AF: 0.0105 AC: 15196 AN: 1444138 Hom.: 143 Cov.: 30 AF XY: 0.0112 AC XY: 8011 AN XY: 716374

African (AFR) AF: 0.00111 AC: 37 AN: 33318

American (AMR) AF: 0.00210 AC: 88 AN: 41814

Ashkenazi Jewish (ASJ) AF: 0.00483 AC: 124 AN: 25650

East Asian (EAS) AF: 0.0000513 AC: 2 AN: 38974

South Asian (SAS) AF: 0.0386 AC: 3201 AN: 83020

European-Finnish (FIN) AF: 0.0133 AC: 689 AN: 51828

Middle Eastern (MID) AF: 0.00940 AC: 54 AN: 5746

European-Non Finnish (NFE) AF: 0.00946 AC: 10448 AN: 1104070

Other (OTH) AF: 0.00926 AC: 553 AN: 59718

GnomAD4 genome AF: 0.00775 AC: 1181 AN: 152306 Hom.: 19 Cov.: 33 AF XY: 0.00794 AC XY: 591 AN XY: 74476

African (AFR) AF: 0.00168 AC: 70 AN: 41560

American (AMR) AF: 0.00418 AC: 64 AN: 15306

Ashkenazi Jewish (ASJ) AF: 0.00519 AC: 18 AN: 3468

East Asian (EAS) AF: 0.00 AC: 0 AN: 5180

South Asian (SAS) AF: 0.0423 AC: 204 AN: 4824

European-Finnish (FIN) AF: 0.0110 AC: 117 AN: 10618

Middle Eastern (MID) AF: 0.0170 AC: 5 AN: 294

European-Non Finnish (NFE) AF: 0.00979 AC: 666 AN: 68028

Other (OTH) AF: 0.00851 AC: 18 AN: 2116

Alfa AF: 0.00731 Hom.: 1

Asia WGS AF: 0.0240 AC: 82 AN: 3478

ClinVar

Significance: Benign

Submissions summary: Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Benign:1

Dec 31, 2019

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.7
Mutation Taster		=84/16	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs552710042; hg19: chr7-127292433; COSMIC: COSV61243093; COSMIC: COSV61243093;