7-128252168-GAGAGTATGCGGGGACAAAGT-G

Variant names:

• chr7-128252168-GAGAGTATGCGGGGACAAAGT-G
• rs773667205
• NM_000230.3:c.144+10_144+29delGTATGCGGGGACAAAGTAGA

Variant summary

Our verdict is Likely benign. The variant received -2 ACMG points: 0P and 2B. BP6_Moderate

The ENST00000308868.5(LEP):​c.144+7_144+26delAGAGTATGCGGGGACAAAGT variant causes a splice region, intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000223 in 1,614,012 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★).

• Frequency:
  • Genomes: 𝑓 0.000026 (0 hom., cov: 32)
  • Exomes 𝑓: 0.000022 (0 hom.)
• Consequence: LEP ENST00000308868.5 splice_region, intron
• Clinical Significance: Likely benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 1.76

Genes affected

LEP (HGNC:6553): (leptin) This gene encodes a protein that is secreted by white adipocytes into the circulation and plays a major role in the regulation of energy homeostasis. Circulating leptin binds to the leptin receptor in the brain, which activates downstream signaling pathways that inhibit feeding and promote energy expenditure. This protein also has several endocrine functions, and is involved in the regulation of immune and inflammatory responses, hematopoiesis, angiogenesis, reproduction, bone formation and wound healing. Mutations in this gene and its regulatory regions cause severe obesity and morbid obesity with hypogonadism in human patients. A mutation in this gene has also been linked to type 2 diabetes mellitus development. [provided by RefSeq, Aug 2017]

ENSG00000289434 (HGNC:):

ACMG classification

Our verdict: Likely_benign. The variant received -2 ACMG points.

• BP6: Variant 7-128252168-GAGAGTATGCGGGGACAAAGT-G is Benign according to our data. Variant chr7-128252168-GAGAGTATGCGGGGACAAAGT-G is described in ClinVar as [Likely_benign]. Clinvar id is 2963137.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
LEP	NM_000230.3	c.144+10_144+29delGTATGCGGGGACAAAGTAGA		intron_variant	Intron 2 of 2	ENST00000308868.5	NP_000221.1
LEP	XM_005250340.6	c.144+10_144+29delGTATGCGGGGACAAAGTAGA		intron_variant	Intron 2 of 2		XP_005250397.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
LEP	ENST00000308868.5	c.144+7_144+26delAGAGTATGCGGGGACAAAGT		splice_region_variant, intron_variant	Intron 2 of 2	1	NM_000230.3	ENSP00000312652.4
ENSG00000289434	ENST00000785131.1	n.168+11174_168+11193delACTTTGTCCCCGCATACTCT		intron_variant	Intron 1 of 1

Frequencies

GnomAD3 genomes AF: 0.0000263 AC: 4 AN: 152180 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000588

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.0000318 AC: 8 AN: 251454 AF XY: 0.0000515

Gnomad AFR exome AF: 0.0000615

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000527

Gnomad OTH exome AF: 0.000163

GnomAD4 exome AF: 0.0000219 AC: 32 AN: 1461832 Hom.: 0 AF XY: 0.0000234 AC XY: 17 AN XY: 727218

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 33480

American (AMR) AF: 0.00 AC: 0 AN: 44724

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26136

East Asian (EAS) AF: 0.00 AC: 0 AN: 39700

South Asian (SAS) AF: 0.00 AC: 0 AN: 86256

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53390

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5768

European-Non Finnish (NFE) AF: 0.0000288 AC: 32 AN: 1111984

Other (OTH) AF: 0.00 AC: 0 AN: 60394

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.000000), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.0000263 AC: 4 AN: 152180 Hom.: 0 Cov.: 32 AF XY: 0.0000404 AC XY: 3 AN XY: 74344

African (AFR) AF: 0.00 AC: 0 AN: 41440

American (AMR) AF: 0.00 AC: 0 AN: 15280

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3468

East Asian (EAS) AF: 0.00 AC: 0 AN: 5202

South Asian (SAS) AF: 0.00 AC: 0 AN: 4830

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10608

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.0000588 AC: 4 AN: 68034

Other (OTH) AF: 0.00 AC: 0 AN: 2090

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.0000340

ClinVar

Significance: Likely benign

Submissions summary: Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Benign:1

Jun 30, 2023

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.8

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

You must be logged in to view publications. This limit was set because tens of millions (!) of queries from AI bots are generated daily.

Other links and lift over

dbSNP: rs773667205; hg19: chr7-127892221;