7-128947297-CACTCTGCAGCCGCCCACTCTGCGGCCGCCT-C

Variant names:

• chr7-128947297-CACTCTGCAGCCGCCCACTCTGCGGCCGCCT-C
• rs60344245
• NM_001098629.3:c.572_601delGGCCGCCTACTCTGCAGCCGCCCACTCTGC

Variant summary

Our verdict is Benign. The variant received -8 ACMG points: 2P and 10B. PM4 BP6_Moderate BA1

The NM_001098629.3(IRF5):​c.572_601delGGCCGCCTACTCTGCAGCCGCCCACTCTGC​(p.Arg191_Leu200del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Benign (★).

• Frequency:
  • Genomes: 𝑓 0.50 (18851 hom., cov: 0)
  • Exomes 𝑓: 0.50 (180811 hom.)
  • Failed GnomAD Quality Control
• Consequence: IRF5 NM_001098629.3 disruptive_inframe_deletion
• Clinical Significance: Benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 0.736
• Publications: 11 publications found

Genes affected

IRF5 (HGNC:6120): (interferon regulatory factor 5) This gene encodes a member of the interferon regulatory factor (IRF) family, a group of transcription factors with diverse roles, including virus-mediated activation of interferon, and modulation of cell growth, differentiation, apoptosis, and immune system activity. Members of the IRF family are characterized by a conserved N-terminal DNA-binding domain containing tryptophan (W) repeats. Alternative promoter use and alternative splicing result in multiple transcript variants, and a 30-nt indel polymorphism (SNP rs60344245) can result in loss of a 10-aa segment. [provided by RefSeq, Dec 2016]

IRF5 Gene-Disease associations (from GenCC):

• systemic lupus erythematosus

  Inheritance: Unknown Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Benign. The variant received -8 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_001098629.3.
• BP6: Variant 7-128947297-CACTCTGCAGCCGCCCACTCTGCGGCCGCCT-C is Benign according to our data. Variant chr7-128947297-CACTCTGCAGCCGCCCACTCTGCGGCCGCCT-C is described in ClinVar as [Benign]. Clinvar id is 768201.Status of the report is criteria_provided_single_submitter, 1 stars.
• BA1: GnomAd4 highest subpopulation (AFR) allele frequency at 95% confidence interval = 0.526 is higher than 0.05.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
IRF5	NM_001098629.3	c.572_601delGGCCGCCTACTCTGCAGCCGCCCACTCTGC	p.Arg191_Leu200del	disruptive_inframe_deletion	Exon 6 of 9	ENST00000357234.10	NP_001092099.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
IRF5	ENST00000357234.10	c.572_601delGGCCGCCTACTCTGCAGCCGCCCACTCTGC	p.Arg191_Leu200del	disruptive_inframe_deletion	Exon 6 of 9	1	NM_001098629.3	ENSP00000349770.5

Frequencies

GnomAD3 genomes AF: 0.495 AC: 75054 AN: 151476 Hom.: 18838 Cov.: 0

Gnomad AFR AF: 0.532

Gnomad AMI AF: 0.597

Gnomad AMR AF: 0.389

Gnomad ASJ AF: 0.605

Gnomad EAS AF: 0.468

Gnomad SAS AF: 0.462

Gnomad FIN AF: 0.474

Gnomad MID AF: 0.471

Gnomad NFE AF: 0.498

Gnomad OTH AF: 0.500

GnomAD2 exomes AF: 0.463 AC: 108068 AN: 233398 AF XY: 0.467

Gnomad AFR exome AF: 0.521

Gnomad AMR exome AF: 0.300

Gnomad ASJ exome AF: 0.585

Gnomad EAS exome AF: 0.485

Gnomad FIN exome AF: 0.470

Gnomad NFE exome AF: 0.492

Gnomad OTH exome AF: 0.465

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.496 AC: 720257 AN: 1451580 Hom.: 180811 AF XY: 0.496 AC XY: 358146 AN XY: 721776

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.529 AC: 17604 AN: 33270

American (AMR) AF: 0.315 AC: 13905 AN: 44194

Ashkenazi Jewish (ASJ) AF: 0.595 AC: 15429 AN: 25910

East Asian (EAS) AF: 0.481 AC: 19032 AN: 39536

South Asian (SAS) AF: 0.459 AC: 39239 AN: 85496

European-Finnish (FIN) AF: 0.476 AC: 24660 AN: 51788

Middle Eastern (MID) AF: 0.497 AC: 2805 AN: 5648

European-Non Finnish (NFE) AF: 0.504 AC: 557672 AN: 1105770

Other (OTH) AF: 0.499 AC: 29911 AN: 59968

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.000000), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.495 AC: 75108 AN: 151594 Hom.: 18851 Cov.: 0 AF XY: 0.490 AC XY: 36268 AN XY: 74040

African (AFR) AF: 0.532 AC: 21974 AN: 41298

American (AMR) AF: 0.388 AC: 5912 AN: 15234

Ashkenazi Jewish (ASJ) AF: 0.605 AC: 2096 AN: 3464

East Asian (EAS) AF: 0.469 AC: 2413 AN: 5146

South Asian (SAS) AF: 0.461 AC: 2211 AN: 4792

European-Finnish (FIN) AF: 0.474 AC: 4992 AN: 10532

Middle Eastern (MID) AF: 0.483 AC: 141 AN: 292

European-Non Finnish (NFE) AF: 0.498 AC: 33778 AN: 67822

Other (OTH) AF: 0.498 AC: 1049 AN: 2106

Alfa AF: 0.498 Hom.: 3203

ClinVar

Significance: Benign

Submissions summary: Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Benign:1

Dec 31, 2019

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.74
Mutation Taster		=193/7	polymorphism (auto)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs60344245; hg19: chr7-128587351; COSMIC: COSV50856661; COSMIC: COSV50856661;