7-154052966-AGGCGGCGGCGCCCCGGGAGCGCGGCGGC-A

Variant names:

• chr7-154052966-AGGCGGCGGCGCCCCGGGAGCGCGGCGGC-A
• rs2129062565
• NM_130797.4:c.157_184delCCCCGGGAGCGCGGCGGCGGCGGCGGCG

Variant summary

Our verdict is Uncertain significance. The variant received 1 ACMG points: 1P and 0B. PP5

The NM_130797.4(DPP6):​c.157_184delCCCCGGGAGCGCGGCGGCGGCGGCGGCG​(p.Pro53AlafsTer35) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000031 in 968,078 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). Variant results in nonsense mediated mRNA decay.

• Frequency:
  • Genomes: not found (cov: 31)
  • Exomes 𝑓: 0.0000031 (0 hom.)
• Consequence: DPP6 NM_130797.4 frameshift
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications P:1 U:1
• Conservation: PhyloP100: 1.30
• Publications: 0 publications found

Genes affected

DPP6 (HGNC:3010): (dipeptidyl peptidase like 6) This gene encodes a single-pass type II membrane protein that is a member of the peptidase S9B family of serine proteases. This protein has no detectable protease activity, most likely due to the absence of the conserved serine residue normally present in the catalytic domain of serine proteases. However, it does bind specific voltage-gated potassium channels and alters their expression and biophysical properties. Variations in this gene may be associated with susceptibility to amyotrophic lateral sclerosis and with idiopathic ventricular fibrillation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]

DPP6 Gene-Disease associations (from GenCC):

• autosomal dominant primary microcephaly

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• paroxysmal familial ventricular fibrillation

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• ventricular fibrillation, paroxysmal familial, 2

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
• intellectual disability, autosomal dominant 33

  Inheritance: Unknown, AD Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics
• complex neurodevelopmental disorder

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

ENSG00000203335 (HGNC:):

ACMG classification

Our verdict: Uncertain_significance. The variant received 1 ACMG points.

• PP5: Variant 7-154052966-AGGCGGCGGCGCCCCGGGAGCGCGGCGGC-A is Pathogenic according to our data. Variant chr7-154052966-AGGCGGCGGCGCCCCGGGAGCGCGGCGGC-A is described in ClinVar as Conflicting_classifications_of_pathogenicity. ClinVar VariationId is 1677676.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_130797.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	DPP6	NM_130797.4	MANE Select	c.157_184delCCCCGGGAGCGCGGCGGCGGCGGCGGCG	p.Pro53AlafsTer35	frameshift	Exon 1 of 26	NP_570629.2	P42658-1
	DPP6	NM_001290253.2		c.157_184delCCCCGGGAGCGCGGCGGCGGCGGCGGCG	p.Pro53AlafsTer35	frameshift	Exon 1 of 6	NP_001277182.1	Q8IYG9
	DPP6	NM_001364497.2		c.60+303969_60+303996delCCCCGGGAGCGCGGCGGCGGCGGCGGCG		intron	N/A	NP_001351426.1	A0A994J7K0

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	DPP6	ENST00000377770.8	TSL:1 MANE Select	c.157_184delCCCCGGGAGCGCGGCGGCGGCGGCGGCG	p.Pro53AlafsTer35	frameshift	Exon 1 of 26	ENSP00000367001.3	P42658-1
	DPP6	ENST00000406326.5	TSL:1	c.157_184delCCCCGGGAGCGCGGCGGCGGCGGCGGCG	p.Pro53AlafsTer35	frameshift	Exon 1 of 6	ENSP00000384393.1	Q8IYG9
	DPP6	ENST00000404039.5	TSL:1	c.51+165243_51+165270delCCCCGGGAGCGCGGCGGCGGCGGCGGCG		intron	N/A	ENSP00000385578.1	E9PF59

Frequencies

GnomAD3 genomes Cov.: 31

GnomAD4 exome AF: 0.00000310 AC: 3 AN: 968078 Hom.: 0 AF XY: 0.00000655 AC XY: 3 AN XY: 458046

African (AFR) AF: 0.00 AC: 0 AN: 18924

American (AMR) AF: 0.000189 AC: 1 AN: 5304

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 9990

East Asian (EAS) AF: 0.00 AC: 0 AN: 14536

South Asian (SAS) AF: 0.00 AC: 0 AN: 22712

European-Finnish (FIN) AF: 0.0000775 AC: 1 AN: 12910

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 2302

European-Non Finnish (NFE) AF: 0.00000118 AC: 1 AN: 846478

Other (OTH) AF: 0.00 AC: 0 AN: 34922

GnomAD4 genome Cov.: 31

ClinVar

ClinVar submissions

Significance: Conflicting classifications of pathogenicity

Revision: criteria provided, conflicting classifications

Pathogenic	VUS	Benign	Condition
-	1	-	not provided (1)
1	-	-	See cases (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs2129062565; hg19: chr7-153750051;