7-2944307-C-CCTTGACCAGCTCGTCATTGTAGCTGTCCCGCTCTTCCTTCAT

Variant names:

• chr7-2944307-C-CCTTGACCAGCTCGTCATTGTAGCTGTCCCGCTCTTCCTTCAT
• NM_032415.7:c.547_588dupATGAAGGAAGAGCGGGACAGCTACAATGACGAGCTGGTCAAG

Variant summary

Our verdict is Uncertain significance. The variant received 3 ACMG points: 3P and 0B. PM4 PP5

The NM_032415.7(CARD11):​c.547_588dupATGAAGGAAGAGCGGGACAGCTACAATGACGAGCTGGTCAAG​(p.Lys196_Val197insMetLysGluGluArgAspSerTyrAsnAspGluLeuValLys) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars). Synonymous variant affecting the same amino acid position (i.e. K196K) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 32)
• Consequence: CARD11 NM_032415.7 conservative_inframe_insertion
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 0.148
• Publications: 0 publications found

Genes affected

CARD11 (HGNC:16393): (caspase recruitment domain family member 11) The protein encoded by this gene belongs to the membrane-associated guanylate kinase (MAGUK) family, a class of proteins that functions as molecular scaffolds for the assembly of multiprotein complexes at specialized regions of the plasma membrane. This protein is also a member of the CARD protein family, which is defined by carrying a characteristic caspase-associated recruitment domain (CARD). This protein has a domain structure similar to that of CARD14 protein. The CARD domains of both proteins have been shown to specifically interact with BCL10, a protein known to function as a positive regulator of cell apoptosis and NF-kappaB activation. When expressed in cells, this protein activated NF-kappaB and induced the phosphorylation of BCL10. [provided by RefSeq, Jul 2008]

CARD11-AS1 (HGNC:40766): (CARD11 antisense RNA 1)

ACMG classification

Our verdict: Uncertain_significance. The variant received 3 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_032415.7.
• PP5: Variant 7-2944307-C-CCTTGACCAGCTCGTCATTGTAGCTGTCCCGCTCTTCCTTCAT is Pathogenic according to our data. Variant chr7-2944307-C-CCTTGACCAGCTCGTCATTGTAGCTGTCCCGCTCTTCCTTCAT is described in ClinVar as Pathogenic. ClinVar VariationId is 1707407.Status of the report is no_assertion_criteria_provided, 0 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_032415.7. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CARD11	NM_032415.7	MANE Select	c.547_588dupATGAAGGAAGAGCGGGACAGCTACAATGACGAGCTGGTCAAG	p.Lys196_Val197insMetLysGluGluArgAspSerTyrAsnAspGluLeuValLys	conservative_inframe_insertion	Exon 5 of 25	NP_115791.3
	CARD11	NM_001324281.3		c.547_588dupATGAAGGAAGAGCGGGACAGCTACAATGACGAGCTGGTCAAG	p.Lys196_Val197insMetLysGluGluArgAspSerTyrAsnAspGluLeuValLys	conservative_inframe_insertion	Exon 6 of 26	NP_001311210.1	Q9BXL7
	CARD11-AS1	NR_187443.1		n.278_319dupACCAGCTCGTCATTGTAGCTGTCCCGCTCTTCCTTCATCTTG		non_coding_transcript_exon	Exon 1 of 2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CARD11	ENST00000396946.9	TSL:1 MANE Select	c.547_588dupATGAAGGAAGAGCGGGACAGCTACAATGACGAGCTGGTCAAG	p.Lys196_Val197insMetLysGluGluArgAspSerTyrAsnAspGluLeuValLys	conservative_inframe_insertion	Exon 5 of 25	ENSP00000380150.4	Q9BXL7
	CARD11-AS1	ENST00000423194.1	TSL:1	n.278_319dupACCAGCTCGTCATTGTAGCTGTCCCGCTCTTCCTTCATCTTG		non_coding_transcript_exon	Exon 1 of 2
	CARD11	ENST00000888804.1		c.547_588dupATGAAGGAAGAGCGGGACAGCTACAATGACGAGCTGGTCAAG	p.Lys196_Val197insMetLysGluGluArgAspSerTyrAsnAspGluLeuValLys	conservative_inframe_insertion	Exon 5 of 25	ENSP00000558863.1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 31

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: no assertion criteria provided

Pathogenic	VUS	Benign	Condition
1	-	-	Immunodeficiency 11b with atopic dermatitis (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.15

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

hg19: chr7-2983941;