7-38726273-T-TCCTGGTCCACGGTTCTTAGCACTG

Variant names:

• chr7-38726273-T-TCCTGGTCCACGGTTCTTAGCACTG
• rs754564437
• NM_014396.4:c.2514_2537dupCAGTGCTAAGAACCGTGGACCAGG

Variant summary

Our verdict is Benign. Variant got -13 ACMG points: 0P and 13B. BP3 BP6_Very_Strong BS2

The NM_014396.4(VPS41):​c.2514_2537dupCAGTGCTAAGAACCGTGGACCAGG​(p.Gly846_Ser847insSerAlaLysAsnArgGlyProGly) variant causes a disruptive inframe insertion change. The variant allele was found at a frequency of 0.00195 in 1,614,002 control chromosomes in the GnomAD database, including 11 homozygotes. Variant has been reported in ClinVar as Likely benign (★★).

• Frequency:
  • Genomes: 𝑓 0.0021 (0 hom., cov: 33)
  • Exomes 𝑓: 0.0019 (11 hom.)
• Consequence: VPS41 NM_014396.4 disruptive_inframe_insertion
• Clinical Significance: Benign/Likely benign criteria provided, multiple submitters, no conflicts B:2
• Conservation: PhyloP100: 6.72

Genes affected

VPS41 (HGNC:12713): (VPS41 subunit of HOPS complex) Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene encodes the human ortholog of yeast Vps41 protein which is also conserved in Drosophila, tomato, and Arabidopsis. Expression studies in yeast and human indicate that this protein may be involved in the formation and fusion of transport vesicles from the Golgi. Several transcript variants encoding different isoforms have been described for this gene, however, the full-length nature of not all is known. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Benign. Variant got -13 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_014396.4
• BP6: Variant 7-38726273-T-TCCTGGTCCACGGTTCTTAGCACTG is Benign according to our data. Variant chr7-38726273-T-TCCTGGTCCACGGTTCTTAGCACTG is described in ClinVar as [Likely_benign]. Clinvar id is 2359877.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BS2: High Homozygotes in GnomAdExome4 at 11 AR gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
VPS41	NM_014396.4	c.2514_2537dupCAGTGCTAAGAACCGTGGACCAGG	p.Gly846_Ser847insSerAlaLysAsnArgGlyProGly	disruptive_inframe_insertion	Exon 29 of 29	ENST00000310301.9	NP_055211.2
VPS41	NM_080631.4	c.2439_2462dupCAGTGCTAAGAACCGTGGACCAGG	p.Gly821_Ser822insSerAlaLysAsnArgGlyProGly	disruptive_inframe_insertion	Exon 28 of 28		NP_542198.2
VPS41	XM_017011988.2	c.1359_1382dupCAGTGCTAAGAACCGTGGACCAGG	p.Gly461_Ser462insSerAlaLysAsnArgGlyProGly	disruptive_inframe_insertion	Exon 16 of 16		XP_016867477.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
VPS41	ENST00000310301.9	c.2514_2537dupCAGTGCTAAGAACCGTGGACCAGG	p.Gly846_Ser847insSerAlaLysAsnArgGlyProGly	disruptive_inframe_insertion	Exon 29 of 29	1	NM_014396.4	ENSP00000309457.4

Frequencies

GnomAD3 genomes AF: 0.00212 AC: 322 AN: 152222 Hom.: 0 Cov.: 33

Gnomad AFR AF: 0.000458

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000393

Gnomad ASJ AF: 0.000288

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.000414

Gnomad FIN AF: 0.0162

Gnomad MID AF: 0.00633

Gnomad NFE AF: 0.00169

Gnomad OTH AF: 0.00239

GnomAD3 exomes AF: 0.00237 AC: 589 AN: 248998 Hom.: 8 AF XY: 0.00242 AC XY: 326 AN XY: 134778

Gnomad AFR exome AF: 0.000308

Gnomad AMR exome AF: 0.000318

Gnomad ASJ exome AF: 0.0000993

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.000915

Gnomad FIN exome AF: 0.0149

Gnomad NFE exome AF: 0.00189

Gnomad OTH exome AF: 0.00180

GnomAD4 exome AF: 0.00193 AC: 2818 AN: 1461662 Hom.: 11 Cov.: 29 AF XY: 0.00191 AC XY: 1386 AN XY: 727154

Gnomad4 AFR exome AF: 0.000329

Gnomad4 AMR exome AF: 0.000380

Gnomad4 ASJ exome AF: 0.000306

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.000672

Gnomad4 FIN exome AF: 0.0137

Gnomad4 NFE exome AF: 0.00171

Gnomad4 OTH exome AF: 0.00149

GnomAD4 genome AF: 0.00211 AC: 322 AN: 152340 Hom.: 0 Cov.: 33 AF XY: 0.00279 AC XY: 208 AN XY: 74500

Gnomad4 AFR AF: 0.000457

Gnomad4 AMR AF: 0.000392

Gnomad4 ASJ AF: 0.000288

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.000415

Gnomad4 FIN AF: 0.0162

Gnomad4 NFE AF: 0.00169

Gnomad4 OTH AF: 0.00236

Alfa AF: 0.00107 Hom.: 0

ClinVar

Significance: Benign/Likely benign

Submissions summary: Benign:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Inborn genetic diseases Benign:1

Mar 10, 2022

Ambry Genetics

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This alteration is classified as benign based on a combination of the following: seen in unaffected individuals, population frequency, intact protein function, lack of segregation with disease, co-occurrence, RNA analysis, in silico models, amino acid conservation, lack of disease association in case-control studies, and/or the mechanism of disease or impacted region is inconsistent with a known cause of pathogenicity. -

not provided Benign:1

Apr 01, 2025

CeGaT Center for Human Genetics Tuebingen

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

VPS41: PM4, BS1 -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs754564437; hg19: chr7-38765873;