7-5973397-GGTCAGTTCTGAGAAATGACACCCAGGTTGGCGATGTGTCTCATGGTTGGCCTTCCATGGGGACAGTTCCAGGGGTGGTCCATCTCCCCCATGTGGGTGATCAGTTTCTTCATCTCGCTTGTGTTAAGAGCAGTCCCAATCATCACCTGAGTGTGAGACACAATGGTTCAACGTTTTAGTAGTTTTTTGACGTCAGAATGGCAGCTCTTCAGAAGCATTCTTCTCTAAAATAAGGCTGGACAAGATTACAGCTCAAAAACTACCTTCCCTGAAAAACCTTCCCCCAGAGAAGCCTAGGTTCTAGATCTCAGCCCTCC-G

Variant names:

• chr7-5973397-GGTCAGTTCTGAGAAATGACACCCAGGTTGGCGATGTGTCTCATGGTTGGCCTTCCATGGGGACAGTTCCAGGGGTGGTCCATCTCCCCCATGTGGGTGATCAGTTTCTTCATCTCGCTTGTGTTAAGAGCAGTCCCAATCATCACCTGAGTGTGAGACACAATGGTTCAACGTTTTAGTAGTTTTTTGACGTCAGAATGGCAGCTCTTCAGAAGCATTCTTCTCTAAAATAAGGCTGGACAAGATTACAGCTCAAAAACTACCTTCCCTGAAAAACCTTCCCCCAGAGAAGCCTAGGTTCTAGATCTCAGCCCTCC-G
• NM_000535.7:c.2446-171_*1del

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PVS1_Strong

The ENST00000382321.5(PMS2):​c.1243-171_*1del variant causes a exon loss, splice acceptor, splice region, intron change involving the alteration of a conserved nucleotide. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: not found (cov: 18)
• Consequence: PMS2 ENST00000382321.5 exon_loss, splice_acceptor, splice_region, intron
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 8.83

Genes affected

PMS2 (HGNC:9122): (PMS1 homolog 2, mismatch repair system component) The protein encoded by this gene is a key component of the mismatch repair system that functions to correct DNA mismatches and small insertions and deletions that can occur during DNA replication and homologous recombination. This protein forms heterodimers with the gene product of the mutL homolog 1 (MLH1) gene to form the MutL-alpha heterodimer. The MutL-alpha heterodimer possesses an endonucleolytic activity that is activated following recognition of mismatches and insertion/deletion loops by the MutS-alpha and MutS-beta heterodimers, and is necessary for removal of the mismatched DNA. There is a DQHA(X)2E(X)4E motif found at the C-terminus of the protein encoded by this gene that forms part of the active site of the nuclease. Mutations in this gene have been associated with hereditary nonpolyposis colorectal cancer (HNPCC; also known as Lynch syndrome) and Turcot syndrome. [provided by RefSeq, Apr 2016]

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.103896104 fraction of the gene. No cryptic splice site detected. Exon removal is inframe change.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
PMS2	NM_000535.7	c.2446-171_*1del	p.Val816fs	frameshift_variant, stop_lost, splice_region_variant	Exon 15 of 15	ENST00000265849.12	NP_000526.2
PMS2	NM_000535.7	c.2454-171_*1del		splice_acceptor_variant, splice_region_variant, 3_prime_UTR_variant, intron_variant	Exon 15 of 15	ENST00000265849.12	NP_000526.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
PMS2	ENST00000265849.12	c.2446-171_*1del	p.Val816fs	frameshift_variant, stop_lost, splice_region_variant	Exon 15 of 15	1	NM_000535.7	ENSP00000265849.7
PMS2	ENST00000265849	c.2445-171_*1del		splice_acceptor_variant, splice_region_variant, 3_prime_UTR_variant, intron_variant	Exon 15 of 15	1	NM_000535.7	ENSP00000265849.7

Frequencies

GnomAD3 genomes Cov.: 18

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 18

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Lynch syndrome 4 Pathogenic:1

Apr 01, 2019

Department of Pathology and Laboratory Medicine, Sinai Health System

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: research

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr7-6013028;