7-6374755-T-TGGTGGTGGGAGACGGGTGAGTGCGC

Position:

• chr7-6374755-T-TGGTGGTGGGAGACGGGTGAGTGCGC

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2

The NM_006908.5(RAC1):​c.23_35+12dupTGGTGGGAGACGGGTGAGTGCGCGG variant causes a intron change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 31)
• Consequence: RAC1 NM_006908.5 intron
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 4.02

Genes affected

RAC1 (HGNC:9801): (Rac family small GTPase 1) The protein encoded by this gene is a GTPase which belongs to the RAS superfamily of small GTP-binding proteins. Members of this superfamily appear to regulate a diverse array of cellular events, including the control of cell growth, cytoskeletal reorganization, and the activation of protein kinases. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]

RAC1 (HGNC:):

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
RAC1	NM_006908.5	c.23_35+12dupTGGTGGGAGACGGGTGAGTGCGCGG		intron_variant		ENST00000348035.9	NP_008839.2
RAC1	NM_018890.4	c.23_35+12dupTGGTGGGAGACGGGTGAGTGCGCGG		intron_variant			NP_061485.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
RAC1	ENST00000348035.9	c.23_35+12dupTGGTGGGAGACGGGTGAGTGCGCGG		intron_variant		1	NM_006908.5	ENSP00000258737.7

Frequencies

GnomAD3 genomes Cov.: 31

GnomAD4 exome Cov.: 30

GnomAD4 genome Cov.: 31

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not specified Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Al Jalila Children’s Genomics Center, Al Jalila Childrens Speciality Hospital

Mar 30, 2020

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr7-6414386;