7-6374755-T-TGGTGGTGGGAGACGGGTGAGTGCGC

Variant names:

• chr7-6374755-T-TGGTGGTGGGAGACGGGTGAGTGCGC
• rs2115177185
• ENST00000488373.5:n.132_133insGTGAGTGCGCGGTGGTGGGAGACGG

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The ENST00000348035.9(RAC1):​c.-42_-41insGTGAGTGCGCGGTGGTGGGAGACGG variant causes a 5 prime UTR change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 31)
• Consequence: RAC1 ENST00000348035.9 5_prime_UTR
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 4.02
• Publications: 0 publications found

Genes affected

RAC1 (HGNC:9801): (Rac family small GTPase 1) The protein encoded by this gene is a GTPase which belongs to the RAS superfamily of small GTP-binding proteins. Members of this superfamily appear to regulate a diverse array of cellular events, including the control of cell growth, cytoskeletal reorganization, and the activation of protein kinases. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]

RAC1 Gene-Disease associations (from GenCC):

• intellectual disability, autosomal dominant 48

  Inheritance: AD Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, G2P, Illumina, Ambry Genetics

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
RAC1	NM_006908.5	c.23_35+12dupTGGTGGGAGACGGGTGAGTGCGCGG		intron_variant	Intron 1 of 5	ENST00000348035.9	NP_008839.2
RAC1	NM_018890.4	c.23_35+12dupTGGTGGGAGACGGGTGAGTGCGCGG		intron_variant	Intron 1 of 6		NP_061485.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
RAC1	ENST00000348035.9	c.-42_-41insGTGAGTGCGCGGTGGTGGGAGACGG		5_prime_UTR_variant	Exon 1 of 6	1	NM_006908.5	ENSP00000258737.7

Frequencies

GnomAD3 genomes Cov.: 31

GnomAD4 exome Cov.: 30

GnomAD4 genome Cov.: 31

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not specified Uncertain:1

Mar 30, 2020

Al Jalila Children’s Genomics Center, Al Jalila Childrens Speciality Hospital

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.0

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs2115177185; hg19: chr7-6414386;