7-74059905-CGTGGCTCCTGGAGTTGGCGTGGCTCCTGGTGTCGGT-C
Variant summary
Our verdict is Likely benign. The variant received -6 ACMG points: 0P and 6B. BP3BP6BS2
The NM_000501.4(ELN):c.1453_1488delGTGGCTCCTGGTGTCGGTGTGGCTCCTGGAGTTGGC(p.Val485_Gly496del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000988 in 151,854 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).
Frequency
Consequence
NM_000501.4 conservative_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -6 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000501.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| ELN | NM_000501.4 | MANE Select | c.1453_1488delGTGGCTCCTGGTGTCGGTGTGGCTCCTGGAGTTGGC | p.Val485_Gly496del | conservative_inframe_deletion | Exon 23 of 33 | NP_000492.2 | P15502-2 | |
| ELN | NM_001278939.2 | c.1540_1575delGTGGCTCCTGGTGTCGGTGTGGCTCCTGGAGTTGGC | p.Val514_Gly525del | conservative_inframe_deletion | Exon 24 of 34 | NP_001265868.1 | P15502-3 | ||
| ELN | NM_001278915.2 | c.1471_1506delGTGGCTCCTGGTGTCGGTGTGGCTCCTGGAGTTGGC | p.Val491_Gly502del | conservative_inframe_deletion | Exon 23 of 33 | NP_001265844.1 | P15502-1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| ELN | ENST00000252034.12 | TSL:1 MANE Select | c.1453_1488delGTGGCTCCTGGTGTCGGTGTGGCTCCTGGAGTTGGC | p.Val485_Gly496del | conservative_inframe_deletion | Exon 23 of 33 | ENSP00000252034.7 | P15502-2 | |
| ELN | ENST00000380562.8 | TSL:1 | c.1471_1506delGTGGCTCCTGGTGTCGGTGTGGCTCCTGGAGTTGGC | p.Val491_Gly502del | conservative_inframe_deletion | Exon 23 of 33 | ENSP00000369936.4 | P15502-1 | |
| ELN | ENST00000458204.5 | TSL:1 | c.1423_1458delGTGGCTCCTGGTGTCGGTGTGGCTCCTGGAGTTGGC | p.Val475_Gly486del | conservative_inframe_deletion | Exon 22 of 32 | ENSP00000403162.1 | E7EN65 |
Frequencies
GnomAD3 genomes AF: 0.0000989 AC: 15AN: 151736Hom.: 0 Cov.: 32 show subpopulations
GnomAD2 exomes AF: 0.0000596 AC: 15AN: 251468 AF XY: 0.0000441 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000142 AC: 182AN: 1280740Hom.: 0 AF XY: 0.000145 AC XY: 94AN XY: 646406 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.0000988 AC: 15AN: 151854Hom.: 0 Cov.: 32 AF XY: 0.0000404 AC XY: 3AN XY: 74190 show subpopulations
Age Distribution
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at