7-78019385-GGCCCCGGCGCGACGGCGGCCTTGCGCGCCGGGGC-G

Variant names:

• chr7-78019385-GGCCCCGGCGCGACGGCGGCCTTGCGCGCCGGGGC-G
• rs1808058702
• NM_012301.4:c.4264_4297delGCCCCGGCGCGCAAGGCCGCCGTCGCGCCGGGGC

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PVS1_Moderate

The NM_012301.4(MAGI2):​c.4264_4297delGCCCCGGCGCGCAAGGCCGCCGTCGCGCCGGGGC​(p.Ala1422ProfsTer41) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00000182 in 1,100,316 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: not found (cov: 30)
  • Exomes 𝑓: 0.0000018 (0 hom.)
• Consequence: MAGI2 NM_012301.4 frameshift
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 8.98
• Publications: 0 publications found

Genes affected

MAGI2 (HGNC:18957): (membrane associated guanylate kinase, WW and PDZ domain containing 2) The protein encoded by this gene interacts with atrophin-1. Atrophin-1 contains a polyglutamine repeat, expansion of which is responsible for dentatorubral and pallidoluysian atrophy. This encoded protein is characterized by two WW domains, a guanylate kinase-like domain, and multiple PDZ domains. It has structural similarity to the membrane-associated guanylate kinase homologue (MAGUK) family. [provided by RefSeq, Jul 2008]

MAGI2 Gene-Disease associations (from GenCC):

• nephrotic syndrome 15

  Inheritance: AR Classification: STRONG, LIMITED Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)
• familial idiopathic steroid-resistant nephrotic syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• genetic developmental and epileptic encephalopathy

  Inheritance: AD Classification: LIMITED Submitted by: G2P
• epilepsy

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.0238 CDS is truncated, and there are 0 pathogenic variants in the truncated region.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MAGI2	NM_012301.4	c.4264_4297delGCCCCGGCGCGCAAGGCCGCCGTCGCGCCGGGGC	p.Ala1422ProfsTer41	frameshift_variant	Exon 22 of 22	ENST00000354212.9	NP_036433.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MAGI2	ENST00000354212.9	c.4264_4297delGCCCCGGCGCGCAAGGCCGCCGTCGCGCCGGGGC	p.Ala1422ProfsTer41	frameshift_variant	Exon 22 of 22	1	NM_012301.4	ENSP00000346151.4

Frequencies

GnomAD3 genomes Cov.: 30

GnomAD4 exome AF: 0.00000182 AC: 2 AN: 1100316 Hom.: 0 AF XY: 0.00000190 AC XY: 1 AN XY: 525976

African (AFR) AF: 0.00 AC: 0 AN: 22468

American (AMR) AF: 0.00 AC: 0 AN: 8728

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 15722

East Asian (EAS) AF: 0.00 AC: 0 AN: 25934

South Asian (SAS) AF: 0.0000372 AC: 1 AN: 26882

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 21932

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 3102

European-Non Finnish (NFE) AF: 0.00000107 AC: 1 AN: 931748

Other (OTH) AF: 0.00 AC: 0 AN: 43800

GnomAD4 genome Cov.: 30

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.00000378

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Nephrotic syndrome 15 Uncertain:1

May 22, 2022

3billion

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The variant is not observed in the gnomAD v2.1.1 dataset. Frameshift: predicted to result in a loss or disruption of normal protein function through protein truncation. The predicted truncated protein may be shortened by less than 10%. Therefore, this variant is classified as uncertain significanceaccording to the recommendation of ACMG/AMP guideline. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.0

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1808058702; hg19: chr7-77648702;