8-100213275-GCGGGCGGCGGCGCCACCGGGCATC-GCGGGCGGCGGCGCCACCGGGCATCCGGGCGGCGGCGCCACCGGGCATC

Variant names:

• chr8-100213275-G-GCGGGCGGCGGCGCCACCGGGCATC
• rs781380303
• NM_003114.5:c.1293_1316dupCGCCACCGGGCATCCGGGCGGCGG

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_003114.5(SPAG1):​c.1293_1316dupCGCCACCGGGCATCCGGGCGGCGG​(p.Gly439_Gln440insAlaThrGlyHisProGlyGlyGly) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000564 in 1,064,386 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: not found (cov: 33)
  • Exomes 𝑓: 0.0000056 (0 hom.)
• Consequence: SPAG1 NM_003114.5 disruptive_inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.0320
• Publications: 0 publications found

Genes affected

SPAG1 (HGNC:11212): (sperm associated antigen 1) The correlation of anti-sperm antibodies with cases of unexplained infertility implicates a role for these antibodies in blocking fertilization. Improved diagnosis and treatment of immunologic infertility, as well as identification of proteins for targeted contraception, are dependent on the identification and characterization of relevant sperm antigens. The protein expressed by this gene is recognized by anti-sperm agglutinating antibodies from an infertile woman. Furthermore, immunization of female rats with the recombinant human protein reduced fertility. This protein localizes to the plasma membrane of germ cells in the testis and to the post-acrosomal plasma membrane of mature spermatozoa. Recombinant polypeptide binds GTP and exhibits GTPase activity. Thus, this protein may regulate GTP signal transduction pathways involved in spermatogenesis and fertilization. Two transcript variants of this gene encode the same protein. [provided by RefSeq, Jul 2008]

SPAG1 Gene-Disease associations (from GenCC):

• primary ciliary dyskinesia 28

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), ClinGen, PanelApp Australia, G2P
• primary ciliary dyskinesia

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_003114.5.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_003114.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SPAG1	NM_003114.5	MANE Select	c.1293_1316dupCGCCACCGGGCATCCGGGCGGCGG	p.Gly439_Gln440insAlaThrGlyHisProGlyGlyGly	disruptive_inframe_insertion	Exon 11 of 19	NP_003105.2
	SPAG1	NM_001374321.1		c.1293_1316dupCGCCACCGGGCATCCGGGCGGCGG	p.Gly439_Gln440insAlaThrGlyHisProGlyGlyGly	disruptive_inframe_insertion	Exon 11 of 19	NP_001361250.1
	SPAG1	NM_172218.3		c.1293_1316dupCGCCACCGGGCATCCGGGCGGCGG	p.Gly439_Gln440insAlaThrGlyHisProGlyGlyGly	disruptive_inframe_insertion	Exon 11 of 19	NP_757367.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SPAG1	ENST00000388798.7	TSL:1 MANE Select	c.1293_1316dupCGCCACCGGGCATCCGGGCGGCGG	p.Gly439_Gln440insAlaThrGlyHisProGlyGlyGly	disruptive_inframe_insertion	Exon 11 of 19	ENSP00000373450.3
	SPAG1	ENST00000251809.4	TSL:5	c.1293_1316dupCGCCACCGGGCATCCGGGCGGCGG	p.Gly439_Gln440insAlaThrGlyHisProGlyGlyGly	disruptive_inframe_insertion	Exon 11 of 19	ENSP00000251809.3
	SPAG1	ENST00000964470.1		c.1293_1316dupCGCCACCGGGCATCCGGGCGGCGG	p.Gly439_Gln440insAlaThrGlyHisProGlyGlyGly	disruptive_inframe_insertion	Exon 11 of 19	ENSP00000634529.1

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome AF: 0.00000564 AC: 6 AN: 1064386 Hom.: 0 Cov.: 32 AF XY: 0.00000790 AC XY: 4 AN XY: 506210

African (AFR) AF: 0.00 AC: 0 AN: 21878

American (AMR) AF: 0.00 AC: 0 AN: 7516

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 12976

East Asian (EAS) AF: 0.00 AC: 0 AN: 24286

South Asian (SAS) AF: 0.000153 AC: 3 AN: 19590

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 21314

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 2808

European-Non Finnish (NFE) AF: 0.00000329 AC: 3 AN: 912182

Other (OTH) AF: 0.00 AC: 0 AN: 41836

GnomAD4 genome Cov.: 33

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.032

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs781380303; hg19: chr8-101225503;