8-11808709-G-GTCCCACTCCCACTCCCACTCCCAC

Variant names:

• chr8-11808709-G-GTCCCACTCCCACTCCCACTCCCAC
• rs71711801
• NM_004462.5:c.100-69_100-46dupCACTCCCACTCCCACTCCCACTCC

Variant summary

Our verdict is Benign. The variant received -13 ACMG points: 0P and 13B. BP3 BP6_Very_Strong BS2

The NM_001287750.2(FDFT1):​c.208_231dupCACTCCCACTCCCACTCCCACTCC​(p.His70_Ser77dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★★).

• Frequency:
  • Genomes: 𝑓 0.0017 (0 hom., cov: 0)
  • Exomes 𝑓: 0.0017 (9 hom.)
• Consequence: FDFT1 NM_001287750.2 conservative_inframe_insertion
• Clinical Significance: Benign/Likely benign criteria provided, multiple submitters, no conflicts B:3
• Conservation: PhyloP100: 0.258
• Publications: 15 publications found

Genes affected

FDFT1 (HGNC:3629): (farnesyl-diphosphate farnesyltransferase 1) This gene encodes a membrane-associated enzyme located at a branch point in the mevalonate pathway. The encoded protein is the first specific enzyme in cholesterol biosynthesis, catalyzing the dimerization of two molecules of farnesyl diphosphate in a two-step reaction to form squalene. [provided by RefSeq, Jul 2008]

FDFT1 Gene-Disease associations (from GenCC):

• retinitis pigmentosa

  Inheritance: AR Classification: LIMITED Submitted by: G2P
• squalene synthase deficiency

  Inheritance: AR Classification: LIMITED Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), G2P

ACMG classification

Our verdict: Benign. The variant received -13 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_001287750.2
• BP6: Variant 8-11808709-G-GTCCCACTCCCACTCCCACTCCCAC is Benign according to our data. Variant chr8-11808709-G-GTCCCACTCCCACTCCCACTCCCAC is described in ClinVar as Benign/Likely_benign. ClinVar VariationId is 3051193.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BS2: High Homozygotes in GnomAdExome4 at 9 AR gene

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001287750.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	FDFT1	NM_004462.5	MANE Select	c.100-69_100-46dupCACTCCCACTCCCACTCCCACTCC		intron	N/A	NP_004453.3
	FDFT1	NM_001287750.2		c.208_231dupCACTCCCACTCCCACTCCCACTCC	p.His70_Ser77dup	conservative_inframe_insertion	Exon 1 of 7	NP_001274679.1	A0A1W2PQ47
	FDFT1	NM_001287742.2		c.100-69_100-46dupCACTCCCACTCCCACTCCCACTCC		intron	N/A	NP_001274671.1	Q6IAX1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	FDFT1	ENST00000220584.9	TSL:1 MANE Select	c.100-69_100-46dupCACTCCCACTCCCACTCCCACTCC		intron	N/A	ENSP00000220584.4	P37268-1
	FDFT1	ENST00000529464.5	TSL:1	n.100-942_100-919dupCACTCCCACTCCCACTCCCACTCC		intron	N/A	ENSP00000434770.1	E9PNJ2
	FDFT1	ENST00000525954.5	TSL:2	c.208_231dupCACTCCCACTCCCACTCCCACTCC	p.His70_Ser77dup	conservative_inframe_insertion	Exon 1 of 7	ENSP00000491537.1	A0A1W2PQ47

Frequencies

GnomAD3 genomes AF: 0.00167 AC: 248 AN: 148920 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.000326

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000797

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.000201

Gnomad SAS AF: 0.0127

Gnomad FIN AF: 0.00340

Gnomad MID AF: 0.00321

Gnomad NFE AF: 0.00184

Gnomad OTH AF: 0.00147

GnomAD4 exome AF: 0.00170 AC: 2317 AN: 1366046 Hom.: 9 Cov.: 0 AF XY: 0.00198 AC XY: 1330 AN XY: 672636

African (AFR) AF: 0.000127 AC: 4 AN: 31492

American (AMR) AF: 0.000655 AC: 23 AN: 35136

Ashkenazi Jewish (ASJ) AF: 0.000298 AC: 7 AN: 23468

East Asian (EAS) AF: 0.0000279 AC: 1 AN: 35834

South Asian (SAS) AF: 0.00745 AC: 566 AN: 75936

European-Finnish (FIN) AF: 0.00329 AC: 131 AN: 39866

Middle Eastern (MID) AF: 0.00269 AC: 15 AN: 5568

European-Non Finnish (NFE) AF: 0.00140 AC: 1484 AN: 1061696

Other (OTH) AF: 0.00151 AC: 86 AN: 57050

GnomAD4 genome AF: 0.00167 AC: 249 AN: 149032 Hom.: 0 Cov.: 0 AF XY: 0.00189 AC XY: 137 AN XY: 72634

African (AFR) AF: 0.000350 AC: 14 AN: 40010

American (AMR) AF: 0.000796 AC: 12 AN: 15082

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3456

East Asian (EAS) AF: 0.000202 AC: 1 AN: 4952

South Asian (SAS) AF: 0.0127 AC: 59 AN: 4652

European-Finnish (FIN) AF: 0.00340 AC: 35 AN: 10296

Middle Eastern (MID) AF: 0.00345 AC: 1 AN: 290

European-Non Finnish (NFE) AF: 0.00184 AC: 124 AN: 67320

Other (OTH) AF: 0.00145 AC: 3 AN: 2068

Alfa AF: 0.00201 Hom.: 2006

ClinVar

ClinVar submissions

Significance: Benign/Likely benign

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	-	1	FDFT1-related disorder (1)
-	-	1	not provided (1)
-	-	1	not specified (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.26
Mutation Taster		=100/0	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs71711801; hg19: chr8-11666218;