8-11808709-GTCCCACTCCCACTCCCACTCCCACTCCCAC-GTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCAC

Variant names:

• chr8-11808709-G-GTCCCACTCCCACTCCCACTCCCACTCCCAC
• rs71711801
• NM_004462.5:c.100-75_100-46dupCACTCCCACTCCCACTCCCACTCCCACTCC

Variant summary

Our verdict is Likely benign. The variant received -5 ACMG points: 0P and 5B. BP3 BS2

The NM_001287750.2(FDFT1):​c.202_231dupCACTCCCACTCCCACTCCCACTCCCACTCC​(p.His68_Ser77dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★).

• Frequency:
  • Genomes: 𝑓 0.00033 (0 hom., cov: 0)
  • Exomes 𝑓: 0.00040 (4 hom.)
• Consequence: FDFT1 NM_001287750.2 conservative_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:2
• Conservation: PhyloP100: 0.258
• Publications: 15 publications found

Genes affected

FDFT1 (HGNC:3629): (farnesyl-diphosphate farnesyltransferase 1) This gene encodes a membrane-associated enzyme located at a branch point in the mevalonate pathway. The encoded protein is the first specific enzyme in cholesterol biosynthesis, catalyzing the dimerization of two molecules of farnesyl diphosphate in a two-step reaction to form squalene. [provided by RefSeq, Jul 2008]

FDFT1 Gene-Disease associations (from GenCC):

• retinitis pigmentosa

  Inheritance: AR Classification: LIMITED Submitted by: G2P
• squalene synthase deficiency

  Inheritance: AR Classification: LIMITED Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), G2P

ACMG classification

Our verdict: Likely_benign. The variant received -5 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_001287750.2
• BS2: High Homozygotes in GnomAdExome4 at 4 AR gene

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001287750.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	FDFT1	NM_004462.5	MANE Select	c.100-75_100-46dupCACTCCCACTCCCACTCCCACTCCCACTCC		intron	N/A	NP_004453.3
	FDFT1	NM_001287750.2		c.202_231dupCACTCCCACTCCCACTCCCACTCCCACTCC	p.His68_Ser77dup	conservative_inframe_insertion	Exon 1 of 7	NP_001274679.1	A0A1W2PQ47
	FDFT1	NM_001287742.2		c.100-75_100-46dupCACTCCCACTCCCACTCCCACTCCCACTCC		intron	N/A	NP_001274671.1	Q6IAX1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	FDFT1	ENST00000220584.9	TSL:1 MANE Select	c.100-75_100-46dupCACTCCCACTCCCACTCCCACTCCCACTCC		intron	N/A	ENSP00000220584.4	P37268-1
	FDFT1	ENST00000529464.5	TSL:1	n.100-948_100-919dupCACTCCCACTCCCACTCCCACTCCCACTCC		intron	N/A	ENSP00000434770.1	E9PNJ2
	FDFT1	ENST00000525954.5	TSL:2	c.202_231dupCACTCCCACTCCCACTCCCACTCCCACTCC	p.His68_Ser77dup	conservative_inframe_insertion	Exon 1 of 7	ENSP00000491537.1	A0A1W2PQ47

Frequencies

GnomAD3 genomes AF: 0.000329 AC: 49 AN: 148922 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000398

Gnomad ASJ AF: 0.00145

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00301

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00321

Gnomad NFE AF: 0.000297

Gnomad OTH AF: 0.00147

GnomAD4 exome AF: 0.000401 AC: 548 AN: 1366048 Hom.: 4 Cov.: 0 AF XY: 0.000513 AC XY: 345 AN XY: 672634

African (AFR) AF: 0.0000318 AC: 1 AN: 31492

American (AMR) AF: 0.000569 AC: 20 AN: 35138

Ashkenazi Jewish (ASJ) AF: 0.000810 AC: 19 AN: 23468

East Asian (EAS) AF: 0.000781 AC: 28 AN: 35832

South Asian (SAS) AF: 0.00408 AC: 310 AN: 75938

European-Finnish (FIN) AF: 0.0000251 AC: 1 AN: 39866

Middle Eastern (MID) AF: 0.000898 AC: 5 AN: 5568

European-Non Finnish (NFE) AF: 0.000128 AC: 136 AN: 1061696

Other (OTH) AF: 0.000491 AC: 28 AN: 57050

GnomAD4 genome AF: 0.000329 AC: 49 AN: 149034 Hom.: 0 Cov.: 0 AF XY: 0.000385 AC XY: 28 AN XY: 72636

African (AFR) AF: 0.00 AC: 0 AN: 40010

American (AMR) AF: 0.000398 AC: 6 AN: 15082

Ashkenazi Jewish (ASJ) AF: 0.00145 AC: 5 AN: 3456

East Asian (EAS) AF: 0.00 AC: 0 AN: 4952

South Asian (SAS) AF: 0.00301 AC: 14 AN: 4654

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10296

Middle Eastern (MID) AF: 0.00345 AC: 1 AN: 290

European-Non Finnish (NFE) AF: 0.000297 AC: 20 AN: 67320

Other (OTH) AF: 0.00145 AC: 3 AN: 2068

Alfa AF: 0.00 Hom.: 2006

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	1	-	not provided (1)
-	1	-	Squalene synthase deficiency (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.26
Mutation Taster		=100/0	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs71711801; hg19: chr8-11666218;