8-1763857-GCAGGGAGCCCGGCTGAGTGGCAGCCCAGGTGAGCGCT-G
Variant summary
Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PVS1_StrongPM2
The NM_018941.4(CLN8):c.-139_-124+21delCTGAGTGGCAGCCCAGGTGAGCGCTCAGGGAGCCCGG variant causes a splice donor, splice region, 5 prime UTR, intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000661 in 151,210 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_018941.4 splice_donor, splice_region, 5_prime_UTR, intron
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Likely_pathogenic. Variant got 6 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
CLN8 | NM_018941.4 | c.-139_-124+21delCTGAGTGGCAGCCCAGGTGAGCGCTCAGGGAGCCCGG | splice_region_variant | Exon 1 of 3 | ENST00000331222.6 | NP_061764.2 | ||
CLN8 | NM_018941.4 | c.-139_-124+21delCTGAGTGGCAGCCCAGGTGAGCGCTCAGGGAGCCCGG | splice_donor_variant, splice_region_variant, 5_prime_UTR_variant, intron_variant | Exon 1 of 3 | ENST00000331222.6 | NP_061764.2 | ||
CLN8 | NM_018941.4 | c.-139_-124+21delCTGAGTGGCAGCCCAGGTGAGCGCTCAGGGAGCCCGG | non_coding_transcript_variant | ENST00000331222.6 | NP_061764.2 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
CLN8 | ENST00000331222.6 | c.-139_-124+21delCTGAGTGGCAGCCCAGGTGAGCGCTCAGGGAGCCCGG | splice_region_variant | Exon 1 of 3 | 1 | NM_018941.4 | ENSP00000328182.4 | |||
CLN8 | ENST00000331222 | c.-139_-124+21delCTGAGTGGCAGCCCAGGTGAGCGCTCAGGGAGCCCGG | splice_donor_variant, splice_region_variant, 5_prime_UTR_variant, intron_variant | Exon 1 of 3 | 1 | NM_018941.4 | ENSP00000328182.4 | |||
CLN8 | ENST00000331222.6 | c.-139_-124+21delCTGAGTGGCAGCCCAGGTGAGCGCTCAGGGAGCCCGG | non_coding_transcript_variant | 1 | NM_018941.4 | ENSP00000328182.4 | ||||
KBTBD11-OT1 | ENST00000635855.1 | n.-195_-159delCTGAGTGGCAGCCCAGGTGAGCGCTCAGGGAGCCCGG | non_coding_transcript_exon_variant | Exon 1 of 30 | 5 | ENSP00000489726.1 | ||||
KBTBD11-OT1 | ENST00000635855.1 | n.-195_-159delCTGAGTGGCAGCCCAGGTGAGCGCTCAGGGAGCCCGG | 5_prime_UTR_variant | Exon 1 of 30 | 5 | ENSP00000489726.1 | ||||
KBTBD11-OT1 | ENST00000635855.1 | n.-207_-171delCAGGGAGCCCGGCTGAGTGGCAGCCCAGGTGAGCGCT | upstream_gene_variant | 5 | ENSP00000489726.1 |
Frequencies
GnomAD3 genomes AF: 0.00000661 AC: 1AN: 151210Hom.: 0 Cov.: 27
GnomAD4 genome AF: 0.00000661 AC: 1AN: 151210Hom.: 0 Cov.: 27 AF XY: 0.00 AC XY: 0AN XY: 73820
ClinVar
Submissions by phenotype
not provided Uncertain:1
A variant of uncertain significance has been identified in the CLN8 gene. The c. -139_-124+21del37 variant has not been published as a pathogenic variant, nor has it been reported as a benign variant to our knowledge. No data are available from control populations to assess the frequency of this variant. This variant spans the 3' end of the noncoding exon 1 and the donor site of intron 2. Several in-silico splice prediction models predict that c. -139_-124+21del37 variant may destroy the natural donor site and lead to abnormal gene splicing. However, in the absence of RNA/functional studies, the actual effect of this sequence change in this individual is unknown. Additionally, to our knowledge, splice and regulatory variants have not been reported in CLN8 in association with NCL (Stenson et al., 2014). Therefore, based on the currently available information, it is unclear whether this variant is a pathogenic variant or a rare benign variant. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at