8-73976049-AGGCGGCAGGCGGGCGGCAGGCGGGCGGCAGGCGGGCGGCAGGCGGGCGGCAGGCGGGCGGCAGGCG-AGGCGGCAGGCGGGCGGCAGGCGGGCGGCAGGCGGGCGGCAGGCG

Variant names:

• chr8-73976049-AGGCGGCAGGCGGGCGGCAGGCG-A
• rs71269968
• ENST00000520167.5:n.317+89_317+110delGGCGGCAGGCGGGCGGCAGGCG

Variant summary

Our verdict is Benign. The variant received -10 ACMG points: 0P and 10B. BP6_Moderate BS1 BS2

The ENST00000520167.5(TMEM70):​n.317+89_317+110delGGCGGCAGGCGGGCGGCAGGCG variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.012 in 226,034 control chromosomes in the GnomAD database, including 73 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★).

• Frequency:
  • Genomes: 𝑓 0.016 (22 hom., cov: 0)
  • Exomes 𝑓: 0.0084 (51 hom.)
• Consequence: TMEM70 ENST00000520167.5 intron
• Clinical Significance: Likely benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 0.351
• Publications: 1 publications found

Genes affected

TMEM70 (HGNC:26050): (transmembrane protein 70) This gene likely encodes a mitochondrial membrane protein. The encoded protein may play a role in biogenesis of mitochondrial ATP synthase. Mutations in this gene have been associated with neonatal mitochondrial encephalocardiomyopathy due to ATP synthase deficiency. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2010]

TMEM70 Gene-Disease associations (from GenCC):

• mitochondrial complex V (ATP synthase) deficiency, nuclear type 2

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: G2P, Labcorp Genetics (formerly Invitae), Orphanet
• mitochondrial disease

  Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen

ACMG classification

Our verdict: Benign. The variant received -10 ACMG points.

• BP6: Variant 8-73976049-AGGCGGCAGGCGGGCGGCAGGCG-A is Benign according to our data. Variant chr8-73976049-AGGCGGCAGGCGGGCGGCAGGCG-A is described in ClinVar as Likely_benign. ClinVar VariationId is 1200878.Status of the report is criteria_provided_single_submitter, 1 stars.
• BS1: Variant frequency is greater than expected in population sas. GnomAd4 allele frequency = 0.0164 (1698/103476) while in subpopulation SAS AF = 0.0238 (72/3020). AF 95% confidence interval is 0.0208. There are 22 homozygotes in GnomAd4. There are 840 alleles in the male GnomAd4 subpopulation. Median coverage is 0. This position passed quality control check.
• BS2: High Homozygotes in GnomAd4 at 22 AR gene

Variant Effect in Transcripts

ACMG analysis was done for transcript: ENST00000520167.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TMEM70	NM_017866.6	MANE Select	c.-232_-211delGGCGGCAGGCGGGCGGCAGGCG		upstream_gene	N/A	NP_060336.3
	TMEM70	NM_001040613.3		c.-232_-211delGGCGGCAGGCGGGCGGCAGGCG		upstream_gene	N/A	NP_001035703.1	Q9BUB7-3
	TMEM70	NR_033334.2		n.-145_-124delGGCGGCAGGCGGGCGGCAGGCG		upstream_gene	N/A

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TMEM70	ENST00000520167.5	TSL:2	n.317+89_317+110delGGCGGCAGGCGGGCGGCAGGCG		intron	N/A
	TMEM70	ENST00000523794.1	TSL:3	n.574+89_574+110delGGCGGCAGGCGGGCGGCAGGCG		intron	N/A
	TMEM70	ENST00000312184.6	TSL:1 MANE Select	c.-232_-211delGGCGGCAGGCGGGCGGCAGGCG		upstream_gene	N/A	ENSP00000312599.5	Q9BUB7-1

Frequencies

GnomAD3 genomes AF: 0.0165 AC: 1701 AN: 103388 Hom.: 22 Cov.: 0

Gnomad AFR AF: 0.00845

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0148

Gnomad ASJ AF: 0.0152

Gnomad EAS AF: 0.00660

Gnomad SAS AF: 0.0238

Gnomad FIN AF: 0.0263

Gnomad MID AF: 0.0124

Gnomad NFE AF: 0.0219

Gnomad OTH AF: 0.0146

GnomAD4 exome AF: 0.00836 AC: 1025 AN: 122558 Hom.: 51 AF XY: 0.00803 AC XY: 527 AN XY: 65590

African (AFR) AF: 0.00470 AC: 23 AN: 4896

American (AMR) AF: 0.00215 AC: 20 AN: 9316

Ashkenazi Jewish (ASJ) AF: 0.00645 AC: 39 AN: 6042

East Asian (EAS) AF: 0.00611 AC: 35 AN: 5730

South Asian (SAS) AF: 0.00144 AC: 22 AN: 15230

European-Finnish (FIN) AF: 0.0171 AC: 113 AN: 6600

Middle Eastern (MID) AF: 0.00941 AC: 7 AN: 744

European-Non Finnish (NFE) AF: 0.0107 AC: 704 AN: 66078

Other (OTH) AF: 0.00783 AC: 62 AN: 7922

GnomAD4 genome AF: 0.0164 AC: 1698 AN: 103476 Hom.: 22 Cov.: 0 AF XY: 0.0167 AC XY: 840 AN XY: 50256

African (AFR) AF: 0.00839 AC: 267 AN: 31812

American (AMR) AF: 0.0147 AC: 165 AN: 11234

Ashkenazi Jewish (ASJ) AF: 0.0152 AC: 42 AN: 2770

East Asian (EAS) AF: 0.00664 AC: 20 AN: 3014

South Asian (SAS) AF: 0.0238 AC: 72 AN: 3020

European-Finnish (FIN) AF: 0.0263 AC: 149 AN: 5666

Middle Eastern (MID) AF: 0.00909 AC: 2 AN: 220

European-Non Finnish (NFE) AF: 0.0219 AC: 961 AN: 43808

Other (OTH) AF: 0.0145 AC: 20 AN: 1380

Alfa AF: 0.00666 Hom.: 39

ClinVar

ClinVar submissions as Germline

Significance: Likely benign

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	-	1	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.35

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs71269968; hg19: chr8-74888284;