8-73976049-AGGCGGCAGGCGGGCGGCAGGCGGGCGGCAGGCGGGCGGCAGGCGGGCGGCAGGCGGGCGGCAGGCG-AGGCGGCAGGCGGGCGGCAGGCGGGCGGCAGGCGGGCGGCAGGCGGGCGGCAGGCG

Variant names:

• chr8-73976049-AGGCGGCAGGCG-A
• rs71269968
• ENST00000520167.5:n.317+89_317+99delGGCGGCAGGCG

Variant summary

Our verdict is Benign. The variant received -10 ACMG points: 0P and 10B. BP6_Moderate BA1

The ENST00000520167.5(TMEM70):​n.317+89_317+99delGGCGGCAGGCG variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0301 in 224,972 control chromosomes in the GnomAD database, including 255 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★).

• Frequency:
  • Genomes: 𝑓 0.058 (202 hom., cov: 0)
  • Exomes 𝑓: 0.0068 (53 hom.)
• Consequence: TMEM70 ENST00000520167.5 intron
• Clinical Significance: Likely benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 0.457
• Publications: 1 publications found

Genes affected

TMEM70 (HGNC:26050): (transmembrane protein 70) This gene likely encodes a mitochondrial membrane protein. The encoded protein may play a role in biogenesis of mitochondrial ATP synthase. Mutations in this gene have been associated with neonatal mitochondrial encephalocardiomyopathy due to ATP synthase deficiency. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2010]

TMEM70 Gene-Disease associations (from GenCC):

• mitochondrial complex V (ATP synthase) deficiency, nuclear type 2

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: G2P, Labcorp Genetics (formerly Invitae), Orphanet
• mitochondrial disease

  Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen

ACMG classification

Our verdict: Benign. The variant received -10 ACMG points.

• BP6: Variant 8-73976049-AGGCGGCAGGCG-A is Benign according to our data. Variant chr8-73976049-AGGCGGCAGGCG-A is described in ClinVar as Likely_benign. ClinVar VariationId is 1183909.Status of the report is criteria_provided_single_submitter, 1 stars.
• BA1: GnomAd4 highest subpopulation (EAS) allele frequency at 95% confidence interval = 0.0688 is higher than 0.05.

Variant Effect in Transcripts

ACMG analysis was done for transcript: ENST00000520167.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TMEM70	NM_017866.6	MANE Select	c.-232_-222delGGCGGCAGGCG		upstream_gene	N/A	NP_060336.3
	TMEM70	NM_001040613.3		c.-232_-222delGGCGGCAGGCG		upstream_gene	N/A	NP_001035703.1	Q9BUB7-3
	TMEM70	NR_033334.2		n.-145_-135delGGCGGCAGGCG		upstream_gene	N/A

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TMEM70	ENST00000520167.5	TSL:2	n.317+89_317+99delGGCGGCAGGCG		intron	N/A
	TMEM70	ENST00000523794.1	TSL:3	n.574+89_574+99delGGCGGCAGGCG		intron	N/A
	TMEM70	ENST00000312184.6	TSL:1 MANE Select	c.-232_-222delGGCGGCAGGCG		upstream_gene	N/A	ENSP00000312599.5	Q9BUB7-1

Frequencies

GnomAD3 genomes AF: 0.0575 AC: 5934 AN: 103170 Hom.: 203 Cov.: 0

Gnomad AFR AF: 0.0587

Gnomad AMI AF: 0.0309

Gnomad AMR AF: 0.0497

Gnomad ASJ AF: 0.0474

Gnomad EAS AF: 0.0765

Gnomad SAS AF: 0.0767

Gnomad FIN AF: 0.0444

Gnomad MID AF: 0.0496

Gnomad NFE AF: 0.0587

Gnomad OTH AF: 0.0565

GnomAD4 exome AF: 0.00683 AC: 831 AN: 121718 Hom.: 53 AF XY: 0.00707 AC XY: 461 AN XY: 65194

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00825 AC: 40 AN: 4848

American (AMR) AF: 0.00345 AC: 32 AN: 9270

Ashkenazi Jewish (ASJ) AF: 0.00452 AC: 27 AN: 5980

East Asian (EAS) AF: 0.00760 AC: 43 AN: 5660

South Asian (SAS) AF: 0.00302 AC: 46 AN: 15230

European-Finnish (FIN) AF: 0.0107 AC: 70 AN: 6544

Middle Eastern (MID) AF: 0.00804 AC: 6 AN: 746

European-Non Finnish (NFE) AF: 0.00774 AC: 508 AN: 65606

Other (OTH) AF: 0.00753 AC: 59 AN: 7834

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.0576 AC: 5944 AN: 103254 Hom.: 202 Cov.: 0 AF XY: 0.0570 AC XY: 2860 AN XY: 50134

African (AFR) AF: 0.0588 AC: 1866 AN: 31746

American (AMR) AF: 0.0497 AC: 556 AN: 11194

Ashkenazi Jewish (ASJ) AF: 0.0474 AC: 131 AN: 2766

East Asian (EAS) AF: 0.0769 AC: 231 AN: 3002

South Asian (SAS) AF: 0.0765 AC: 230 AN: 3006

European-Finnish (FIN) AF: 0.0444 AC: 251 AN: 5658

Middle Eastern (MID) AF: 0.0545 AC: 12 AN: 220

European-Non Finnish (NFE) AF: 0.0588 AC: 2571 AN: 43734

Other (OTH) AF: 0.0573 AC: 79 AN: 1378

Alfa AF: 0.00816 Hom.: 39

ClinVar

ClinVar submissions as Germline

Significance: Likely benign

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	-	1	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.46

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs71269968; hg19: chr8-74888284;