8-73976049-AGGCGGCAGGCGGGCGGCAGGCGGGCGGCAGGCGGGCGGCAGGCGGGCGGCAGGCGGGCGGCAGGCG-AGGCGGCAGGCGGGCGGCAGGCGGGCGGCAGGCGGGCGGCAGGCGGGCGGCAGGCGGGCGGCAGGCGGGCGGCAGGCG

Variant names:

• chr8-73976049-A-AGGCGGCAGGCG
• rs71269968
• ENST00000520167.5:n.317+88_317+89insGGCGGCAGGCG

Variant summary

Our verdict is Benign. The variant received -8 ACMG points: 0P and 8B. BA1

The ENST00000520167.5(TMEM70):​n.317+88_317+89insGGCGGCAGGCG variant causes a intron change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.15 (3352 hom., cov: 0)
  • Exomes 𝑓: 0.00035 (1 hom.)
  • Failed GnomAD Quality Control
• Consequence: TMEM70 ENST00000520167.5 intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.111
• Publications: 1 publications found

Genes affected

TMEM70 (HGNC:26050): (transmembrane protein 70) This gene likely encodes a mitochondrial membrane protein. The encoded protein may play a role in biogenesis of mitochondrial ATP synthase. Mutations in this gene have been associated with neonatal mitochondrial encephalocardiomyopathy due to ATP synthase deficiency. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2010]

TMEM70 Gene-Disease associations (from GenCC):

• mitochondrial complex V (ATP synthase) deficiency, nuclear type 2

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: G2P, Labcorp Genetics (formerly Invitae), Orphanet
• mitochondrial disease

  Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen

ACMG classification

Our verdict: Benign. The variant received -8 ACMG points.

• BA1: GnomAd4 highest subpopulation (NFE) allele frequency at 95% confidence interval = 0.18 is higher than 0.05.

Variant Effect in Transcripts

ACMG analysis was done for transcript: ENST00000520167.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TMEM70	NM_017866.6	MANE Select	c.-233_-232insGGCGGCAGGCG		upstream_gene	N/A	NP_060336.3
	TMEM70	NM_001040613.3		c.-233_-232insGGCGGCAGGCG		upstream_gene	N/A	NP_001035703.1	Q9BUB7-3
	TMEM70	NR_033334.2		n.-146_-145insGGCGGCAGGCG		upstream_gene	N/A

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TMEM70	ENST00000520167.5	TSL:2	n.317+88_317+89insGGCGGCAGGCG		intron	N/A
	TMEM70	ENST00000523794.1	TSL:3	n.574+88_574+89insGGCGGCAGGCG		intron	N/A
	TMEM70	ENST00000312184.6	TSL:1 MANE Select	c.-233_-232insGGCGGCAGGCG		upstream_gene	N/A	ENSP00000312599.5	Q9BUB7-1

Frequencies

GnomAD3 genomes AF: 0.155 AC: 15935 AN: 102922 Hom.: 3347 Cov.: 0

Gnomad AFR AF: 0.129

Gnomad AMI AF: 0.0906

Gnomad AMR AF: 0.140

Gnomad ASJ AF: 0.161

Gnomad EAS AF: 0.172

Gnomad SAS AF: 0.129

Gnomad FIN AF: 0.115

Gnomad MID AF: 0.122

Gnomad NFE AF: 0.183

Gnomad OTH AF: 0.164

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000350 AC: 43 AN: 122692 Hom.: 1 Cov.: 0 AF XY: 0.000396 AC XY: 26 AN XY: 65668

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 4892

American (AMR) AF: 0.000107 AC: 1 AN: 9322

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 6046

East Asian (EAS) AF: 0.000174 AC: 1 AN: 5732

South Asian (SAS) AF: 0.000131 AC: 2 AN: 15262

European-Finnish (FIN) AF: 0.000455 AC: 3 AN: 6594

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 748

European-Non Finnish (NFE) AF: 0.000514 AC: 34 AN: 66162

Other (OTH) AF: 0.000252 AC: 2 AN: 7934

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.155 AC: 15943 AN: 103010 Hom.: 3352 Cov.: 0 AF XY: 0.151 AC XY: 7558 AN XY: 50032

African (AFR) AF: 0.129 AC: 4084 AN: 31656

American (AMR) AF: 0.140 AC: 1562 AN: 11126

Ashkenazi Jewish (ASJ) AF: 0.161 AC: 445 AN: 2766

East Asian (EAS) AF: 0.173 AC: 516 AN: 2990

South Asian (SAS) AF: 0.130 AC: 391 AN: 3012

European-Finnish (FIN) AF: 0.115 AC: 649 AN: 5630

Middle Eastern (MID) AF: 0.133 AC: 29 AN: 218

European-Non Finnish (NFE) AF: 0.183 AC: 7996 AN: 43690

Other (OTH) AF: 0.161 AC: 221 AN: 1370

Alfa AF: 0.0588 Hom.: 39

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.11

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs71269968; hg19: chr8-74888284;