8-73976049-AGGCGGCAGGCGGGCGGCAGGCGGGCGGCAGGCGGGCGGCAGGCGGGCGGCAGGCGGGCGGCAGGCG-AGGCGGCAGGCGGGCGGCAGGCGGGCGGCAGGCGGGCGGCAGGCGGGCGGCAGGCGGGCGGCAGGCGGGCGGCAGGCGGGCGGCAGGCG

Variant names:

• chr8-73976049-A-AGGCGGCAGGCGGGCGGCAGGCG
• rs71269968
• ENST00000520167.5:n.317+88_317+89insGGCGGCAGGCGGGCGGCAGGCG

Variant summary

Our verdict is Benign. The variant received -10 ACMG points: 0P and 10B. BP6_Moderate BA1

The ENST00000520167.5(TMEM70):​n.317+88_317+89insGGCGGCAGGCGGGCGGCAGGCG variant causes a intron change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Benign (★).

• Frequency:
  • Genomes: 𝑓 0.084 (1444 hom., cov: 0)
  • Exomes 𝑓: 0.0000081 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: TMEM70 ENST00000520167.5 intron
• Clinical Significance: Benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 0.111
• Publications: 1 publications found

Genes affected

TMEM70 (HGNC:26050): (transmembrane protein 70) This gene likely encodes a mitochondrial membrane protein. The encoded protein may play a role in biogenesis of mitochondrial ATP synthase. Mutations in this gene have been associated with neonatal mitochondrial encephalocardiomyopathy due to ATP synthase deficiency. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2010]

TMEM70 Gene-Disease associations (from GenCC):

• mitochondrial complex V (ATP synthase) deficiency, nuclear type 2

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: G2P, Labcorp Genetics (formerly Invitae), Orphanet
• mitochondrial disease

  Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen

ACMG classification

Our verdict: Benign. The variant received -10 ACMG points.

• BP6: Variant 8-73976049-A-AGGCGGCAGGCGGGCGGCAGGCG is Benign according to our data. Variant chr8-73976049-A-AGGCGGCAGGCGGGCGGCAGGCG is described in ClinVar as Benign. ClinVar VariationId is 1234801.Status of the report is criteria_provided_single_submitter, 1 stars.
• BA1: GnomAd4 highest subpopulation (EAS) allele frequency at 95% confidence interval = 0.12 is higher than 0.05.

Variant Effect in Transcripts

ACMG analysis was done for transcript: ENST00000520167.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TMEM70	NM_017866.6	MANE Select	c.-233_-232insGGCGGCAGGCGGGCGGCAGGCG		upstream_gene	N/A	NP_060336.3
	TMEM70	NM_001040613.3		c.-233_-232insGGCGGCAGGCGGGCGGCAGGCG		upstream_gene	N/A	NP_001035703.1	Q9BUB7-3
	TMEM70	NR_033334.2		n.-146_-145insGGCGGCAGGCGGGCGGCAGGCG		upstream_gene	N/A

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TMEM70	ENST00000520167.5	TSL:2	n.317+88_317+89insGGCGGCAGGCGGGCGGCAGGCG		intron	N/A
	TMEM70	ENST00000523794.1	TSL:3	n.574+88_574+89insGGCGGCAGGCGGGCGGCAGGCG		intron	N/A
	TMEM70	ENST00000312184.6	TSL:1 MANE Select	c.-233_-232insGGCGGCAGGCGGGCGGCAGGCG		upstream_gene	N/A	ENSP00000312599.5	Q9BUB7-1

Frequencies

GnomAD3 genomes AF: 0.0844 AC: 8710 AN: 103250 Hom.: 1441 Cov.: 0

Gnomad AFR AF: 0.0640

Gnomad AMI AF: 0.0688

Gnomad AMR AF: 0.0830

Gnomad ASJ AF: 0.0775

Gnomad EAS AF: 0.129

Gnomad SAS AF: 0.0576

Gnomad FIN AF: 0.0521

Gnomad MID AF: 0.0661

Gnomad NFE AF: 0.103

Gnomad OTH AF: 0.0908

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000815 AC: 1 AN: 122740 Hom.: 0 Cov.: 0 AF XY: 0.0000152 AC XY: 1 AN XY: 65694

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 4898

American (AMR) AF: 0.00 AC: 0 AN: 9322

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 6046

East Asian (EAS) AF: 0.00 AC: 0 AN: 5732

South Asian (SAS) AF: 0.00 AC: 0 AN: 15264

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 6612

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 748

European-Non Finnish (NFE) AF: 0.0000151 AC: 1 AN: 66182

Other (OTH) AF: 0.00 AC: 0 AN: 7936

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.0843 AC: 8714 AN: 103338 Hom.: 1444 Cov.: 0 AF XY: 0.0810 AC XY: 4063 AN XY: 50186

African (AFR) AF: 0.0640 AC: 2033 AN: 31754

American (AMR) AF: 0.0828 AC: 928 AN: 11210

Ashkenazi Jewish (ASJ) AF: 0.0775 AC: 214 AN: 2762

East Asian (EAS) AF: 0.130 AC: 392 AN: 3006

South Asian (SAS) AF: 0.0573 AC: 173 AN: 3018

European-Finnish (FIN) AF: 0.0521 AC: 294 AN: 5648

Middle Eastern (MID) AF: 0.0682 AC: 15 AN: 220

European-Non Finnish (NFE) AF: 0.103 AC: 4503 AN: 43788

Other (OTH) AF: 0.0899 AC: 124 AN: 1380

Alfa AF: 0.0176 Hom.: 39

ClinVar

ClinVar submissions as Germline

Significance: Benign

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	-	1	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.11

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs71269968; hg19: chr8-74888284;