9-127695053-T-TTGATGATGATGATGATGATGA

Variant names:

• chr9-127695052-AT-ATTGATGATGATGATGATGATG
• ENST00000335223.5:c.274_293dupCATCATCATCATCATCATCA

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The ENST00000335223.5(PTRH1):​c.274_293dupCATCATCATCATCATCATCA​(p.Gln98HisfsTer10) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 0)
• Consequence: PTRH1 ENST00000335223.5 frameshift
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.463
• Publications: 0 publications found

Genes affected

PTRH1 (HGNC:27039): (peptidyl-tRNA hydrolase 1 homolog) Enables RNA binding activity. [provided by Alliance of Genome Resources, Apr 2022]

STXBP1 (HGNC:11444): (syntaxin binding protein 1) This gene encodes a syntaxin-binding protein. The encoded protein appears to play a role in release of neurotransmitters via regulation of syntaxin, a transmembrane attachment protein receptor. Mutations in this gene have been associated with infantile epileptic encephalopathy-4. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2010]

STXBP1 Gene-Disease associations (from GenCC):

• developmental and epileptic encephalopathy, 4

  Inheritance: AD, AR Classification: DEFINITIVE, STRONG Submitted by: G2P, Ambry Genetics, PanelApp Australia, Labcorp Genetics (formerly Invitae)
• genetic developmental and epileptic encephalopathy

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
• atypical Rett syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• autosomal dominant non-syndromic intellectual disability

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Dravet syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• infantile spasms

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• undetermined early-onset epileptic encephalopathy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• autism spectrum disorder

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
• intellectual disability

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Variant Effect in Transcripts

ACMG analysis was done for transcript: ENST00000335223.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	STXBP1	NM_001374314.1		c.*38_*57dupTGATGATGATGATGATGATG		3_prime_UTR	Exon 19 of 19	NP_001361243.1	A0A1B0GWF2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PTRH1	ENST00000335223.5	TSL:1	c.274_293dupCATCATCATCATCATCATCA	p.Gln98HisfsTer10	frameshift	Exon 2 of 3	ENSP00000493136.1	A0A286YF52
	STXBP1	ENST00000636962.2	TSL:5	c.*38_*57dupTGATGATGATGATGATGATG		3_prime_UTR	Exon 19 of 19	ENSP00000489762.1	A0A1B0GWF2
	STXBP1	ENST00000635950.2	TSL:5	n.*38_*57dupTGATGATGATGATGATGATG		non_coding_transcript_exon	Exon 19 of 20	ENSP00000490903.1	A0A1B0GWF2

Frequencies

GnomAD3 genomes Cov.: 0

GnomAD4 exome Cov.: 0

GnomAD4 genome Cov.: 0

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.46

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.

Other links and lift over

hg19: chr9-130457331;