9-132905975-GCTCAGGGTTCACGCTGGCGCC-G
Variant summary
Our verdict is Uncertain significance. The variant received 3 ACMG points: 4P and 1B. PM1PM4BP6
The NM_000368.5(TSC1):c.1582_1602delGGCGCCAGCGTGAACCCTGAG(p.Gly528_Glu534del) variant causes a conservative inframe deletion change. The variant allele was found at a frequency of 0.00000372 in 1,614,138 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). Synonymous variant affecting the same amino acid position (i.e. G528G) has been classified as Likely benign.
Frequency
Consequence
NM_000368.5 conservative_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- tuberous sclerosisInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- tuberous sclerosis 1Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, PanelApp Australia, Genomics England PanelApp, G2P, Labcorp Genetics (formerly Invitae)
- lung lymphangioleiomyomatosisInheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
- tuberous sclerosis complexInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 3 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| TSC1 | NM_000368.5 | c.1582_1602delGGCGCCAGCGTGAACCCTGAG | p.Gly528_Glu534del | conservative_inframe_deletion | Exon 15 of 23 | ENST00000298552.9 | NP_000359.1 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| TSC1 | ENST00000298552.9 | c.1582_1602delGGCGCCAGCGTGAACCCTGAG | p.Gly528_Glu534del | conservative_inframe_deletion | Exon 15 of 23 | 1 | NM_000368.5 | ENSP00000298552.3 | ||
| TSC1 | ENST00000490179.4 | c.1582_1602delGGCGCCAGCGTGAACCCTGAG | p.Gly528_Glu534del | conservative_inframe_deletion | Exon 16 of 24 | 3 | ENSP00000495533.2 |
Frequencies
GnomAD3 genomes AF: 0.0000197 AC: 3AN: 152128Hom.: 0 Cov.: 32 show subpopulations
GnomAD2 exomes AF: 0.0000119 AC: 3AN: 251370 AF XY: 0.0000147 show subpopulations
GnomAD4 exome AF: 0.00000205 AC: 3AN: 1461892Hom.: 0 AF XY: 0.00000275 AC XY: 2AN XY: 727246 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.0000197 AC: 3AN: 152246Hom.: 0 Cov.: 32 AF XY: 0.0000134 AC XY: 1AN XY: 74434 show subpopulations
Age Distribution
ClinVar
Submissions by phenotype
Tuberous sclerosis 1 Uncertain:1Benign:1
Tuberous sclerosis syndrome Uncertain:1
This variant causes an in-frame deletion of 7 amino acids at exon 17 of the TSC1 protein. To our knowledge, functional studies have not been reported for this variant. This variant has not been reported in individuals affected with TSC1-related disorders in the literature. This variant has been identified in 3/251370 chromosomes in the general population by the Genome Aggregation Database (gnomAD). The available evidence is insufficient to determine the role of this variant in disease conclusively. Therefore, this variant is classified as a Variant of Uncertain Significance.
not provided Uncertain:1
In-frame deletion of 7 amino acids in a non-repeat region; In silico analysis supports a deleterious effect on protein structure/function; Has not been previously published as pathogenic or benign to our knowledge
Hereditary cancer-predisposing syndrome Benign:1
This alteration is classified as likely benign based on a combination of the following: seen in unaffected individuals, population frequency, intact protein function, lack of segregation with disease, co-occurrence, RNA analysis, in silico models, amino acid conservation, lack of disease association in case-control studies, and/or the mechanism of disease or impacted region is inconsistent with a known cause of pathogenicity.
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at