9-135784482-GCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCC-GCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCC

Variant names:

• chr9-135784482-G-GCTCCCTCCCTCCCTCCCTCC
• rs55843930
• NM_020822.3:c.2944-26_2944-7dupCCCTCCCTCCCTCCCTCCCT

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The NM_020822.3(KCNT1):​c.2944-26_2944-7dupCCCTCCCTCCCTCCCTCCCT variant causes a splice region, intron change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. There is a variant allele frequency bias in the population database for this variant (GnomAdExome4), which may indicate mosaicism or somatic mutations in the reference population data. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.0 (0 hom., cov: 0)
  • Exomes 𝑓: 0.000053 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: KCNT1 NM_020822.3 splice_region, intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.164
• Publications: 0 publications found

Genes affected

KCNT1 (HGNC:18865): (potassium sodium-activated channel subfamily T member 1) Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a sodium-activated potassium channel subunit which is thought to function in ion conductance and developmental signaling pathways. Mutations in this gene cause the early-onset epileptic disorders, malignant migrating partial seizures of infancy and autosomal dominant nocturnal frontal lobe epilepsy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]

KCNT1 Gene-Disease associations (from GenCC):

• childhood-onset epilepsy syndrome

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• developmental and epileptic encephalopathy, 14

  Inheritance: AD Classification: DEFINITIVE, STRONG, MODERATE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), G2P
• malignant migrating partial seizures of infancy

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, Orphanet
• autosomal dominant nocturnal frontal lobe epilepsy 5

  Inheritance: AD Classification: STRONG, MODERATE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)
• autosomal dominant nocturnal frontal lobe epilepsy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_020822.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	KCNT1	NM_020822.3	MANE Select	c.2944-26_2944-7dupCCCTCCCTCCCTCCCTCCCT		splice_region intron	N/A	NP_065873.2
	KCNT1	NM_001272003.2		c.2809-26_2809-7dupCCCTCCCTCCCTCCCTCCCT		splice_region intron	N/A	NP_001258932.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	KCNT1	ENST00000371757.7	TSL:1 MANE Select	c.2944-26_2944-7dupCCCTCCCTCCCTCCCTCCCT		splice_region intron	N/A	ENSP00000360822.2
	KCNT1	ENST00000460750.5	TSL:1	n.*2554-26_*2554-7dupCCCTCCCTCCCTCCCTCCCT		splice_region intron	N/A	ENSP00000418777.1
	KCNT1	ENST00000487664.5	TSL:5	c.2944-26_2944-7dupCCCTCCCTCCCTCCCTCCCT		splice_region intron	N/A	ENSP00000417851.2

Frequencies

GnomAD3 genomes AF: 0.00 AC: 0 AN: 67762 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.0000534 AC: 21 AN: 393594 Hom.: 0 Cov.: 0 AF XY: 0.0000478 AC XY: 10 AN XY: 209114

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 11426

American (AMR) AF: 0.0000430 AC: 1 AN: 23272

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 14030

East Asian (EAS) AF: 0.0000428 AC: 1 AN: 23338

South Asian (SAS) AF: 0.0000433 AC: 2 AN: 46194

European-Finnish (FIN) AF: 0.0000670 AC: 2 AN: 29860

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 1740

European-Non Finnish (NFE) AF: 0.0000541 AC: 12 AN: 221750

Other (OTH) AF: 0.000136 AC: 3 AN: 21984

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome Data not reliable, filtered out with message: AC0;AS_VQSR AF: 0.00 AC: 0 AN: 67822 Hom.: 0 Cov.: 0 AF XY: 0.00 AC XY: 0 AN XY: 31412

African (AFR) AF: 0.00 AC: 0 AN: 15550

American (AMR) AF: 0.00 AC: 0 AN: 7088

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 2188

East Asian (EAS) AF: 0.00 AC: 0 AN: 1916

South Asian (SAS) AF: 0.00 AC: 0 AN: 1704

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 3312

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 122

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 34654

Other (OTH) AF: 0.00 AC: 0 AN: 896

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.16

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs55843930; hg19: chr9-138676328;