9-135784482-GCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCC-GCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCC
Variant summary
Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.
The NM_020822.3(KCNT1):c.2944-26_2944-7dupCCCTCCCTCCCTCCCTCCCT variant causes a splice region, intron change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. There is a variant allele frequency bias in the population database for this variant (GnomAdExome4), which may indicate mosaicism or somatic mutations in the reference population data. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NM_020822.3 splice_region, intron
Scores
Clinical Significance
Conservation
Publications
- childhood-onset epilepsy syndromeInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- developmental and epileptic encephalopathy, 14Inheritance: AD Classification: DEFINITIVE, STRONG, MODERATE Submitted by: Ambry Genetics, G2P, Labcorp Genetics (formerly Invitae)
- malignant migrating partial seizures of infancyInheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, Orphanet
- autosomal dominant nocturnal frontal lobe epilepsy 5Inheritance: AD Classification: STRONG, MODERATE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)
- autosomal dominant nocturnal frontal lobe epilepsyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 0 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_020822.3. You can select a different transcript below to see updated ACMG assignments.
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| KCNT1 | TSL:1 MANE Select | c.2944-53_2944-52insCTCCCTCCCTCCCTCCCTCC | intron | N/A | ENSP00000360822.2 | Q5JUK3-3 | |||
| KCNT1 | TSL:1 | n.*2554-53_*2554-52insCTCCCTCCCTCCCTCCCTCC | intron | N/A | ENSP00000418777.1 | F8WC49 | |||
| KCNT1 | TSL:5 | c.2944-53_2944-52insCTCCCTCCCTCCCTCCCTCC | intron | N/A | ENSP00000417851.2 | Q5JUK3-2 |
Frequencies
GnomAD3 genomes AF: 0.00 AC: 0AN: 67762Hom.: 0 Cov.: 0
GnomAD4 exome AF: 0.0000534 AC: 21AN: 393594Hom.: 0 Cov.: 0 AF XY: 0.0000478 AC XY: 10AN XY: 209114 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome Data not reliable, filtered out with message: AC0;AS_VQSR AF: 0.00 AC: 0AN: 67822Hom.: 0 Cov.: 0 AF XY: 0.00 AC XY: 0AN XY: 31412
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.