9-135784482-GCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCC-GCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCC

Variant names:

• chr9-135784482-G-GCTCCCTCCCTCCCTCCCTCCCTCC
• NM_020822.3:c.2944-30_2944-7dupCCCTCCCTCCCTCCCTCCCTCCCT

Variant summary

Our verdict is Likely benign. Variant got -4 ACMG points: 0P and 4B. BS2

The NM_020822.3(KCNT1):​c.2944-30_2944-7dupCCCTCCCTCCCTCCCTCCCTCCCT variant causes a splice region, intron change involving the alteration of a non-conserved nucleotide. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.0 (0 hom., cov: 0)
  • Exomes 𝑓: 0.000018 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: KCNT1 NM_020822.3 splice_region, intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.164

Genes affected

KCNT1 (HGNC:18865): (potassium sodium-activated channel subfamily T member 1) Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a sodium-activated potassium channel subunit which is thought to function in ion conductance and developmental signaling pathways. Mutations in this gene cause the early-onset epileptic disorders, malignant migrating partial seizures of infancy and autosomal dominant nocturnal frontal lobe epilepsy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]

ACMG classification

Verdict is Likely_benign. Variant got -4 ACMG points.

• BS2: High AC in GnomAdExome4 at 7 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
KCNT1	NM_020822.3	c.2944-30_2944-7dupCCCTCCCTCCCTCCCTCCCTCCCT		splice_region_variant, intron_variant	Intron 25 of 30	ENST00000371757.7	NP_065873.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
KCNT1	ENST00000371757.7	c.2944-53_2944-52insCTCCCTCCCTCCCTCCCTCCCTCC		intron_variant	Intron 25 of 30	1	NM_020822.3	ENSP00000360822.2

Frequencies

GnomAD3 genomes AF: 0.00 AC: 0 AN: 67766 Hom.: 0 Cov.: 0 FAILED QC

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.0000178 AC: 7 AN: 393606 Hom.: 0 Cov.: 0 AF XY: 0.00000956 AC XY: 2 AN XY: 209120

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.0000271

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Data not reliable, filtered out with message: AC0;AS_VQSR AF: 0.00 AC: 0 AN: 67766 Hom.: 0 Cov.: 0 AF XY: 0.00 AC XY: 0 AN XY: 31360

Gnomad4 AFR AF: 0.00

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.00

Gnomad4 OTH AF: 0.00

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr9-138676328;