9-2039776-ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAG-ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG

Variant names:

• chr9-2039776-A-ACAGCAGCAGCAGCAGCAGCAGCAG
• rs113070757
• NM_003070.5:c.684_707dupGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Likely benign. The variant received -5 ACMG points: 0P and 5B. BP3 BS2

The NM_003070.5(SMARCA2):​c.684_707dupGCAGCAGCAGCAGCAGCAGCAGCA​(p.Gln229_Gln236dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000125 in 1,596,244 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Synonymous variant affecting the same amino acid position (i.e. Q236Q) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.000040 (0 hom., cov: 26)
  • Exomes 𝑓: 0.0000097 (0 hom.)
• Consequence: SMARCA2 NM_003070.5 disruptive_inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.00
• Publications: 9 publications found

Genes affected

SMARCA2 (HGNC:11098): (SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2) The protein encoded by this gene is a member of the SWI/SNF family of proteins and is highly similar to the brahma protein of Drosophila. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. Alternatively spliced transcript variants encoding different isoforms have been found for this gene, which contains a trinucleotide repeat (CAG) length polymorphism. [provided by RefSeq, Jan 2014]

SMARCA2 Gene-Disease associations (from GenCC):

• intellectual disability-sparse hair-brachydactyly syndrome

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: PanelApp Australia, G2P, Labcorp Genetics (formerly Invitae), ClinGen, Ambry Genetics, Orphanet
• blepharophimosis-impaired intellectual development syndrome

  Inheritance: AD Classification: STRONG Submitted by: PanelApp Australia

ACMG classification

Our verdict: Likely_benign. The variant received -5 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_003070.5
• BS2: High AC in GnomAd4 at 6 AD gene.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_003070.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SMARCA2	NM_003070.5	MANE Select	c.684_707dupGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln229_Gln236dup	disruptive_inframe_insertion	Exon 4 of 34	NP_003061.3
	SMARCA2	NM_001289396.2		c.684_707dupGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln229_Gln236dup	disruptive_inframe_insertion	Exon 4 of 34	NP_001276325.1	P51531-1
	SMARCA2	NM_139045.4		c.684_707dupGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln229_Gln236dup	disruptive_inframe_insertion	Exon 4 of 33	NP_620614.2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SMARCA2	ENST00000349721.8	TSL:5 MANE Select	c.684_707dupGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln229_Gln236dup	disruptive_inframe_insertion	Exon 4 of 34	ENSP00000265773.5	P51531-1
	SMARCA2	ENST00000382203.5	TSL:1	c.684_707dupGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln229_Gln236dup	disruptive_inframe_insertion	Exon 4 of 34	ENSP00000371638.1	P51531-1
	SMARCA2	ENST00000450198.6	TSL:1	c.684_707dupGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln229_Gln236dup	disruptive_inframe_insertion	Exon 4 of 33	ENSP00000392081.2	F6VDE0

Frequencies

GnomAD3 genomes AF: 0.0000399 AC: 6 AN: 150432 Hom.: 0 Cov.: 26

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000132

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000592

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.00000968 AC: 14 AN: 1445812 Hom.: 0 Cov.: 28 AF XY: 0.00000974 AC XY: 7 AN XY: 718568

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 32784

American (AMR) AF: 0.0000468 AC: 2 AN: 42718

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 25866

East Asian (EAS) AF: 0.00 AC: 0 AN: 38448

South Asian (SAS) AF: 0.00 AC: 0 AN: 84908

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 51680

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5568

European-Non Finnish (NFE) AF: 0.0000109 AC: 12 AN: 1104136

Other (OTH) AF: 0.00 AC: 0 AN: 59704

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.00000143231), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.0000399 AC: 6 AN: 150432 Hom.: 0 Cov.: 26 AF XY: 0.0000409 AC XY: 3 AN XY: 73378

African (AFR) AF: 0.00 AC: 0 AN: 40792

American (AMR) AF: 0.000132 AC: 2 AN: 15108

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3462

East Asian (EAS) AF: 0.00 AC: 0 AN: 5096

South Asian (SAS) AF: 0.00 AC: 0 AN: 4728

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10366

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 314

European-Non Finnish (NFE) AF: 0.0000592 AC: 4 AN: 67592

Other (OTH) AF: 0.00 AC: 0 AN: 2068

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.0
Mutation Taster		=86/14	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.

Other links and lift over

dbSNP: rs113070757;

hg19: chr9-2039776;